Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV 1b target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 3794 rescords (76 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a53335355-13.7121
uuGAUA-UGUUGGAUGAUGGAgu
|| | :| :| ||||:|||
ggCTCTGGCCGCGTACTGCCTga
11.678NO
2hsa-let-7b69656985-12.7121
uuGGUGUGUUGGAUGAUGG--AGU
| |||:: ||||||| |||
ggCGACATG---TACTACCCATCA
11.726NO
3hsa-let-7g93059325-15.7121
ugACAUGUUUGAUGAUGGAgu
|||:| ||| ||||:|
gtTGTGCCTACTCCTACTTtc
9.988NO
4hsa-let-7i25502573-16121
UGUCGUGUUUGA---UGAUGGAGU
|:||| ||::|| :| ||||:|
ATAGCCCAGGCTGAGGCCACCTTA
7.883NO
5hsa-miR-10017941816-14.6121
gUGUUCAAGCCUAG-AUGCCCaa
||: | : || | |:||||
tACGCGCCTCGACCGTGCGGGat
9.137NO
6hsa-miR-10357855807-14.3121
aguAUCGGGACAUGUUACGACGA
| ||:| ||: ||||||
aacTCGCTCCCCCCAGCGCTGCT
9.493NO
7hsa-miR-10757855807-14.3121
acuAUCGGGACAUGUUACGACGA
| ||:| ||: ||||||
aacTCGCTCCCCCCAGCGCTGCT
9.255NO
8hsa-miR-10b17171734-13.1121
UGUUUAAGCCAAGAUGUCCCau
|::|:|||| | |||||
ATGAGTTCGCT----CAGGGgt
6.727NO
9hsa-miR-10b93529370-14.8121
uGUUUAAGCCAAGAUGUCCCau
||| ||| | ||:|||
cCAA--CCGG-TGAACGGGGag
6.727NO
10hsa-miR-122a43624385-17.4121
uguuuGUGGUAACAGUGU-GAGGu
|:||| | |||: ||||
gtgctCGCCACCGCCACGCCTCCg
12.384NO
11hsa-miR-124a187211-12.8121
ACCGUAAGU--GGCG---CACGGAauu
||| | ||| |||| |||||
TGG-A-TCAACCCGCTCAATGCCTgga
5.000NO
12hsa-miR-124a82438260-15.8121
ACCGUAAGUGGCGCACGGAAUU
|| || | |||| |||:||:|
TGACA--C-CCGC-TGCTTTGA
5.000NO
13hsa-miR-125b34863512-18.5121
aguGUUCA---AUCC--CAGAGUCCcu
||:|| |:|| | :|||||
aacCAGGTCGATGGGGAGGTTCAGGtg
10.846NO
14hsa-miR-125b75057534-12.7121
aguguUCAAUCCC--------AGAGUCCCU
|| |||| ||||| ||
gggagAGCCAGGGGACCCCGACCTCAGCGA
10.846NO
15hsa-miR-12631973224-17.1121
CGUAAUAAU----GAGUGCC---AUGCU
||: |||: | |:||| |||||
GCGGGATTGGGCCCACGCGGGCCTACGA
10.720NO
16hsa-miR-127905925-14.3121
ucgguuCGAGUCUGCCUAGGCu
|| || ||| :||||
cgaggtGCGCA-ACGTGTCCGg
5.000NO
17hsa-miR-12720332054-17.1121
ucgGUUCGAGUCUGCCUAGGCu
||| ||:|: ||:|| |
gtgCAACATCGGGGGGGTCGGc
5.000NO
18hsa-miR-12722452273-15.2121
uCG-GUU-CGA-GUCUG----CCUAGGCU
|| ||| ||| || :| ||| :|||
gGCTCAATGCTGCATGCAATTGGACTCGA
5.000NO
19hsa-miR-128a36713698-12.8121
uuuuCUCUG-GCCA---A--GUGACACu
|:|:| || | | ||| |||
ccccGGGGCGCGCTCCATGACACCGTGc
5.472NO
20hsa-miR-128b36713698-12.8121
cuuuCUCUG-GCCA---A--GUGACACu
|:|:| || | | ||| |||
ccccGGGGCGCGCTCCATGACACCGTGc
5.226NO
21hsa-miR-12977197737-15.2121
CGUUCGGGUCUGGCGUUUUuc
|||||:|: :| |||:||
GCAAGTCT--GCGGCAGAAga
5.000NO
22hsa-miR-13230223045-16.32121
GCUGGUAC--CGACAUCUGACaau
|| :|||| ||| ||:|||
CGCTCATGGTGCTCCAGGCTGgca
5.000NO
23hsa-miR-13274097431-12.92121
gCUGGUACCG-ACAUCUGACaau
||| : ||| | |||||
tGACAGCGGCACGGCGACTGgcc
5.000NO
24hsa-miR-13265716591-15.02121
GCUGGUACCGACAUCUGACAAu
|| |::|||| | |:||| |
CG-CTGTGGCGGGTGGCTGCTg
5.000NO
25hsa-miR-133a64516477-13.6121
UGUCGACCAACUUC------CCCUGGUU
|::||| |||:| ||| ||||
ATGGCTCCATGAGGATTGTTGGG-CCAA
5.000NO
26hsa-miR-133b64526477-14.2121
AUCGACCAACUUC------CCCUGGUU
|:||| |||:| ||| ||||
TGGCTCCATGAGGATTGTTGGG-CCAA
NONO
27hsa-miR-13965636579-14.4121
ucuGUGCACGUGACAUCu
|| | ||:||||:|
ttcCA-GGGCGCTGTGGc
5.000NO
28hsa-miR-14356105639-14.5121
ACUCG----AUGU-CAC---GAAGUAGagu
||:|| ||| ||| |||||||
TGGGCGAAACACATGTGGAACTTCATCagc
10.136NO
29hsa-miR-14578407862-16.8121
uUC-CCUAAGGACCCUUUUGACcug
|| ||| ||| | ||||||
tAGAGGAGGCCT--GCAAACTGacg
11.062NO
30hsa-miR-146a782804-12.1121
uuGGGUACCUUAAG-UCAAGAgu
| ||||| :| | :|||||
ggCACATGGTGTCCGGGTTCTgg
NONO
31hsa-miR-146a89088930-18.9121
UUGGGUACCUUA-AGUCAAGAgu
|| || |||| | |||| |||
AAGCCCTGGATTGTCAGATCTac
NONO
32hsa-miR-14790979114-17.6121
cGUCUUCGUAAAGGUGUGug
|||||| | |||:|:|
cCAGAAG--TGTCCGCGCta
5.000NO
33hsa-miR-14720872113-16.6121
cGUCUUCGU-----AAAGGUG--UGUG
|:|||||| |||| ||||
cCGGAAGCACCCCGAGGCCACTTACAC
5.000NO
34hsa-miR-15011481166-12.7121
GUGA-CCAUGUUCCCAACCCucu
|:|| |||| ||||||
CGCTATGTAC----GTTGGGgat
7.336NO
35hsa-miR-15060366058-20.2121
GUGACCAUGUUCCC-AACCCUCU
|:: || ||: ||| ||||||
CGTCGGCACGTGGGCCCGGGAGA
7.336NO
36hsa-miR-15257825806-12.1121
GGGUU---CAAGACAGUACGUGACu
||||| | || | ||:|||
CCCAACTCGCTCCCCCCAGCGCTGc
7.093NO
37hsa-miR-15460916113-15.7121
GCUUCCGUUGUG-CCUAUUGGau
|| || |:| ||:|||||
CGTTCGCTTCGCGGGGTAACCac
5.000NO
38hsa-miR-15a76177635-12.7121
guGUUUGGUAAUACACGACGau
|| :|| ||| |||||
atCACGCC---ATGCGCTGCgg
9.991NO
39hsa-miR-17-3p59415962-16.4121
uGUUC-AC-GGAAGUGACGUCa
|:|| || ||| ||||| :|
gCGAGATGCCCTCCACTGAGGa
6.278NO
40hsa-miR-17-3p84278456-18.9121
uGUUCA-CG---GA------AGUGACGUCa
||||| || || | :||||:|
gCAAGTGGCGTGCTGACGACTAGCTGCGGc
6.278NO
41hsa-miR-17-5p19772006-15.71121
ugauggACGUG-----ACAU-UCGUGAaac
||||| || | ||||||
tttgggTGCACGTGGATGAACAGCACTggg
8.771NO
42hsa-miR-181a24032426-16.3121
ugAGUGGC--UGUCGCAACUUACAa
|||||| ||| || ||:| ||
ctTCACCGGAACATCG-TGGACGTg
9.523NO
43hsa-miR-183760782-17.7121
gUCACUUAAGAUGGUCACGGUAu
|| |:: ||:|||| ||| |
tAGGGGGCGCTGCCAGGGCCCTg
5.000NO
44hsa-miR-18317151745-16.96121
GUCACUUAAGAUGGU--------CACGGUAu
|: |||:||| :|| || ||||
CGATGAGTTCGCTCAGGGGTGGGGTCCCATc
5.000NO
45hsa-miR-18329282948-12.2121
GUCACUUAAGAUGGU-C-ACGGUAu
|:| ||: :||: | ||||||
CGGGGAG----GCCGCGATGCCATc
5.000NO
46hsa-miR-18473807399-19.5121
UGGGAAUAGUCAAGAGGCaggu
|||:||: ||| |||||
ACCTTTGGCAG--CTCCGggtc
5.000NO
47hsa-miR-18750865106-14.1121
gCCGACGU-UGUGUUCUGUGcu
||: ||| || |||| |||
tGGTAGCATAC-CAAGCCACag
5.000NO
48hsa-miR-18737193739-16.3121
gccGACGUUGUGUUCUGUGCu
|| : |||:||:||:|
ttaCTTGGTCACGAGGCATGc
5.000NO
49hsa-miR-18883788401-13.2121
uGGGAGGUGG-UACG-UUCCCuac
||| : ||: || | |||||
tCCCCTGACTAATTCGAAGGGgca
5.000NO
50hsa-miR-18887078730-14.9121
UGGGAGGUGGUACG--UUCCCuac
|| | ||:| || |||||
ACGATGCATCCGGCAAAAGGGtgt
5.000NO
let-7a
Target on hcv 1b 
Binding site 5333-5355
mfe : -13.7
Hybrid sequence
uuGAUA-UGUUGGAUGAUGGAgu
ggCTCTGGCCGCGTACTGCCTga let-7b
Target on hcv 1b 
Binding site 6965-6985
mfe : -12.7
Hybrid sequence
uuGGUGUGUUGGAUGAUGG--AGU
ggCGACATG---TACTACCCATCA let-7g
Target on hcv 1b 
Binding site 9305-9325
mfe : -15.7
Hybrid sequence
ugACAUGUUUGAUGAUGGAgu
gtTGTGCCTACTCCTACTTtc let-7i
Target on hcv 1b 
Binding site 2550-2573
mfe : -16
Hybrid sequence
UGUCGUGUUUGA---UGAUGGAGU
ATAGCCCAGGCTGAGGCCACCTTA miR-100
Target on hcv 1b 
Binding site 1794-1816
mfe : -14.6
Hybrid sequence
gUGUUCAAGCCUAG-AUGCCCaa
tACGCGCCTCGACCGTGCGGGat miR-103
Target on hcv 1b 
Binding site 5785-5807
mfe : -14.3
Hybrid sequence
aguAUCGGGACAUGUUACGACGA
aacTCGCTCCCCCCAGCGCTGCT miR-107
Target on hcv 1b 
Binding site 5785-5807
mfe : -14.3
Hybrid sequence
acuAUCGGGACAUGUUACGACGA
aacTCGCTCCCCCCAGCGCTGCT miR-10b
Target on hcv 1b 
Binding site 1717-1734
mfe : -13.1
Hybrid sequence
UGUUUAAGCCAAGAUGUCCCau
ATGAGTTCGCT----CAGGGgt miR-10b
Target on hcv 1b 
Binding site 9352-9370
mfe : -14.8
Hybrid sequence
uGUUUAAGCCAAGAUGUCCCau
cCAA--CCGG-TGAACGGGGag miR-122a
Target on hcv 1b 
Binding site 4362-4385
mfe : -17.4
Hybrid sequence
uguuuGUGGUAACAGUGU-GAGGu
gtgctCGCCACCGCCACGCCTCCg miR-124a
Target on hcv 1b 
Binding site 187-211
mfe : -12.8
Hybrid sequence
ACCGUAAGU--GGCG---CACGGAauu
TGG-A-TCAACCCGCTCAATGCCTgga miR-124a
Target on hcv 1b 
Binding site 8243-8260
mfe : -15.8
Hybrid sequence
ACCGUAAGUGGCGCACGGAAUU
TGACA--C-CCGC-TGCTTTGA miR-125b
Target on hcv 1b 
Binding site 3486-3512
mfe : -18.5
Hybrid sequence
aguGUUCA---AUCC--CAGAGUCCcu
aacCAGGTCGATGGGGAGGTTCAGGtg miR-125b
Target on hcv 1b 
Binding site 7505-7534
mfe : -12.7
Hybrid sequence
aguguUCAAUCCC--------AGAGUCCCU
gggagAGCCAGGGGACCCCGACCTCAGCGA miR-126
Target on hcv 1b 
Binding site 3197-3224
mfe : -17.1
Hybrid sequence
CGUAAUAAU----GAGUGCC---AUGCU
GCGGGATTGGGCCCACGCGGGCCTACGA miR-127
Target on hcv 1b 
Binding site 905-925
mfe : -14.3
Hybrid sequence
ucgguuCGAGUCUGCCUAGGCu
cgaggtGCGCA-ACGTGTCCGg miR-127
Target on hcv 1b 
Binding site 2033-2054
mfe : -17.1
Hybrid sequence
ucgGUUCGAGUCUGCCUAGGCu
gtgCAACATCGGGGGGGTCGGc miR-127
Target on hcv 1b 
Binding site 2245-2273
mfe : -15.2
Hybrid sequence
uCG-GUU-CGA-GUCUG----CCUAGGCU
gGCTCAATGCTGCATGCAATTGGACTCGA miR-128a
Target on hcv 1b 
Binding site 3671-3698
mfe : -12.8
Hybrid sequence
uuuuCUCUG-GCCA---A--GUGACACu
ccccGGGGCGCGCTCCATGACACCGTGc miR-128b
Target on hcv 1b 
Binding site 3671-3698
mfe : -12.8
Hybrid sequence
cuuuCUCUG-GCCA---A--GUGACACu
ccccGGGGCGCGCTCCATGACACCGTGc miR-129
Target on hcv 1b 
Binding site 7719-7737
mfe : -15.2
Hybrid sequence
CGUUCGGGUCUGGCGUUUUuc
GCAAGTCT--GCGGCAGAAga miR-132
Target on hcv 1b 
Binding site 3022-3045
mfe : -16.32
Hybrid sequence
GCUGGUAC--CGACAUCUGACaau
CGCTCATGGTGCTCCAGGCTGgca miR-132
Target on hcv 1b 
Binding site 7409-7431
mfe : -12.92
Hybrid sequence
gCUGGUACCG-ACAUCUGACaau
tGACAGCGGCACGGCGACTGgcc miR-132
Target on hcv 1b 
Binding site 6571-6591
mfe : -15.02
Hybrid sequence
GCUGGUACCGACAUCUGACAAu
CG-CTGTGGCGGGTGGCTGCTg miR-133a
Target on hcv 1b 
Binding site 6451-6477
mfe : -13.6
Hybrid sequence
UGUCGACCAACUUC------CCCUGGUU
ATGGCTCCATGAGGATTGTTGGG-CCAA miR-133b
Target on hcv 1b 
Binding site 6452-6477
mfe : -14.2
Hybrid sequence
AUCGACCAACUUC------CCCUGGUU
TGGCTCCATGAGGATTGTTGGG-CCAA miR-139
Target on hcv 1b 
Binding site 6563-6579
mfe : -14.4
Hybrid sequence
ucuGUGCACGUGACAUCu
ttcCA-GGGCGCTGTGGc miR-143
Target on hcv 1b 
Binding site 5610-5639
mfe : -14.5
Hybrid sequence
ACUCG----AUGU-CAC---GAAGUAGagu
TGGGCGAAACACATGTGGAACTTCATCagc miR-145
Target on hcv 1b 
Binding site 7840-7862
mfe : -16.8
Hybrid sequence
uUC-CCUAAGGACCCUUUUGACcug
tAGAGGAGGCCT--GCAAACTGacg miR-146a
Target on hcv 1b 
Binding site 782-804
mfe : -12.1
Hybrid sequence
uuGGGUACCUUAAG-UCAAGAgu
ggCACATGGTGTCCGGGTTCTgg miR-146a
Target on hcv 1b 
Binding site 8908-8930
mfe : -18.9
Hybrid sequence
UUGGGUACCUUA-AGUCAAGAgu
AAGCCCTGGATTGTCAGATCTac miR-147
Target on hcv 1b 
Binding site 9097-9114
mfe : -17.6
Hybrid sequence
cGUCUUCGUAAAGGUGUGug
cCAGAAG--TGTCCGCGCta miR-147
Target on hcv 1b 
Binding site 2087-2113
mfe : -16.6
Hybrid sequence
cGUCUUCGU-----AAAGGUG--UGUG
cCGGAAGCACCCCGAGGCCACTTACAC miR-150
Target on hcv 1b 
Binding site 1148-1166
mfe : -12.7
Hybrid sequence
GUGA-CCAUGUUCCCAACCCucu
CGCTATGTAC----GTTGGGgat miR-150
Target on hcv 1b 
Binding site 6036-6058
mfe : -20.2
Hybrid sequence
GUGACCAUGUUCCC-AACCCUCU
CGTCGGCACGTGGGCCCGGGAGA miR-152
Target on hcv 1b 
Binding site 5782-5806
mfe : -12.1
Hybrid sequence
GGGUU---CAAGACAGUACGUGACu
CCCAACTCGCTCCCCCCAGCGCTGc miR-154
Target on hcv 1b 
Binding site 6091-6113
mfe : -15.7
Hybrid sequence
GCUUCCGUUGUG-CCUAUUGGau
CGTTCGCTTCGCGGGGTAACCac miR-15a
Target on hcv 1b 
Binding site 7617-7635
mfe : -12.7
Hybrid sequence
guGUUUGGUAAUACACGACGau
atCACGCC---ATGCGCTGCgg miR-17-3p
Target on hcv 1b 
Binding site 5941-5962
mfe : -16.4
Hybrid sequence
uGUUC-AC-GGAAGUGACGUCa
gCGAGATGCCCTCCACTGAGGa miR-17-3p
Target on hcv 1b 
Binding site 8427-8456
mfe : -18.9
Hybrid sequence
uGUUCA-CG---GA------AGUGACGUCa
gCAAGTGGCGTGCTGACGACTAGCTGCGGc miR-17-5p
Target on hcv 1b 
Binding site 1977-2006
mfe : -15.71
Hybrid sequence
ugauggACGUG-----ACAU-UCGUGAaac
tttgggTGCACGTGGATGAACAGCACTggg miR-181a
Target on hcv 1b 
Binding site 2403-2426
mfe : -16.3
Hybrid sequence
ugAGUGGC--UGUCGCAACUUACAa
ctTCACCGGAACATCG-TGGACGTg miR-183
Target on hcv 1b 
Binding site 760-782
mfe : -17.7
Hybrid sequence
gUCACUUAAGAUGGUCACGGUAu
tAGGGGGCGCTGCCAGGGCCCTg miR-183
Target on hcv 1b 
Binding site 1715-1745
mfe : -16.96
Hybrid sequence
GUCACUUAAGAUGGU--------CACGGUAu
CGATGAGTTCGCTCAGGGGTGGGGTCCCATc miR-183
Target on hcv 1b 
Binding site 2928-2948
mfe : -12.2
Hybrid sequence
GUCACUUAAGAUGGU-C-ACGGUAu
CGGGGAG----GCCGCGATGCCATc miR-184
Target on hcv 1b 
Binding site 7380-7399
mfe : -19.5
Hybrid sequence
UGGGAAUAGUCAAGAGGCaggu
ACCTTTGGCAG--CTCCGggtc miR-187
Target on hcv 1b 
Binding site 5086-5106
mfe : -14.1
Hybrid sequence
gCCGACGU-UGUGUUCUGUGcu
tGGTAGCATAC-CAAGCCACag miR-187
Target on hcv 1b 
Binding site 3719-3739
mfe : -16.3
Hybrid sequence
gccGACGUUGUGUUCUGUGCu
ttaCTTGGTCACGAGGCATGc miR-188
Target on hcv 1b 
Binding site 8378-8401
mfe : -13.2
Hybrid sequence
uGGGAGGUGG-UACG-UUCCCuac
tCCCCTGACTAATTCGAAGGGgca miR-188
Target on hcv 1b 
Binding site 8707-8730
mfe : -14.9
Hybrid sequence
UGGGAGGUGGUACG--UUCCCuac
ACGATGCATCCGGCAAAAGGGtgt