Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV 11a target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 3593 rescords (72 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-736253646-12.9121
guuGUUUUAGUGAUCAGAAGGU
| |:: :| |||| |||
ggcCCAGGGGGCCCGTCTGCCA
5.000NO
2hsa-let-7a30323054-12.7121
uugaUAUGUUGGAUG--AUGGAGu
||| :||| :| ||||||
attgATAGGACC-GCTGTACCTCc
11.678NO
3hsa-let-7b17861809-15.3121
UUGGUGUGUUGG--AUGAUGGagu
|:|| :|| :|: ||||||
AGCCTTACTGCTGGCACTACCcgc
11.726NO
4hsa-let-7b20802102-12.52121
UUGGUG-UGUUGGAUGAUGGagu
|| |:| :|:|: | |||||
AAACGCTGCGATGTCCTACCgat
11.726NO
5hsa-let-7c30323054-12.6121
uuggUAUGUUGGAUG--AUGGAGu
||| :||| :| ||||||
attgATAGGACC-GCTGTACCTCc
11.774NO
6hsa-let-7c91879207-14.3121
uuggUAUGUUGGAUGAUGGAGu
||:|::| | ||||||
ctatATGCGGCAT-GTACCTCt
11.774NO
7hsa-let-7d41234155-14.8121
ugauACGUUGG-----------AUG-AUGGAGa
||||||| | | ||||||
tggcTGCAACCCTGTCCTTTGGTTCATACCTCa
7.888NO
8hsa-let-7e92459267-16.8121
UGAUAUGUUG-GAG-GAUGGAGu
|:|: :|:|| ||| | :||||
ATTGCGCGACGCTCACCGCCTCg
6.037NO
9hsa-let-7g51055130-13.5121
uGA-CAU-GUUUGAU--GAUGG-AGu
|| ||| | || | ||||| ||
cCTGGTAGCCTACCAGGCTACCGTCt
9.988NO
10hsa-let-7g84388463-12.8121
UGACAU-GUU----UGAUGAUGGAGu
|| | : ||| :| :||||| |
ACAGGGTCAATCCTGCGGCTACCGCc
9.988NO
11hsa-let-7i22582282-16.7121
ugUCGUGUU----UGAUGAUGGAgu
||||:|: || :||:|||
tgAGCATAGGTTCACGGCTGCCTgc
7.883NO
12hsa-let-7i92459267-15.8121
UGUCGUGUU-UGA-UGAUGGAGu
|: ||:|:| :|| || :||||
ATTGCGCGACGCTCACCGCCTCg
7.883NO
13hsa-miR-10358405864-12.5121
aguAUCG--GGACAUGUUACGACGA
|||| |:| |:: ||||||
ggtTAGCGGCTTAGCCGGCGCTGCT
9.493NO
14hsa-miR-106a20942121-13.46121
cGAUGG---ACG-UGACAUUCGUGaaaa
||||| ||| | | ||||||
cCTACCGATTGCTTCCGGAAGCACccgg
8.618NO
15hsa-miR-106a60056028-13.2121
cGAUGGAC-GUGACAUUCGUGAaaa
|| :||| ||| ::|||||
cCT-TCTGTCACCAGGGGCACTggt
8.618NO
16hsa-miR-106a11891217-13.7121
cGAUGGA------CG-UGACAUUCGUGAAAA
|| ||| || ||| | |||||||
tCTTCCTGGTAGGGCAACTCTT--CACTTTT
8.618NO
17hsa-miR-10745704595-12.6121
ACUAUCGGGACAU---GUUACGACga
||| | |:||| : |||||| |
TGAGAACTCTGGGCCTCAATGCCGtc
9.255NO
18hsa-miR-10784178454-20.24121
aCUAUCGGG--ACAU-------------GUUACGACGa
|: :|||| |||| |||| ||||
gGGAGGCCCTATGTACAATTCACAGGGTCAATCCTGCg
9.255NO
19hsa-miR-10788038819-15.5121
acuAUCGGGACAUGUUACGACGA
|||||| | ||||||
tccTAGCCCGG------GCTGCT
9.255NO
20hsa-miR-122a44284453-13.1121
uGUUUGUG-GU-AACAG-UGUGAGGu
||||||: || | | :||||:|
cCAAACATACAGGAGACGGCACTTCc
12.384NO
21hsa-miR-124a196220-12.8121
ACCGUAAGU--GGCG---CACGGAauu
||| | ||| |||| |||||
TGG-A-TCAACCCGCTCAATGCCTgga
5.000NO
22hsa-miR-124a43634381-12.4121
acCGUAAGUGGCGCACGGAAUu
||| :|:|| ||||||
caGCA--GGCTGC-CGCCTTAc
5.000NO
23hsa-miR-125a720743-14.7121
guGUCCAAUUUCCCAGAGU-CCCu
|:| | : | |||| |||
tgCGGCCTCGCCGACCTCATGGGg
10.086NO
24hsa-miR-125a21262151-12.6121
GUG--UCCAAUUU---CCCAGAGUCCCu
||| | | ||| ||| ||:|||
CACTTATGCAAAATGTGGG--TCGGGGc
10.086NO
25hsa-miR-125a50025026-13.1121
guGUCCAAUU---UCCCAGAGUCCCU
|||| | | || | :|| ||||
gcCAGGATCATCTAGAG-TTCTGGGA
10.086NO
26hsa-miR-125b719743-14.7121
AGUGUUCAAUC--CCAGAGU-CCCu
|::|:: | | | |||| |||
TTGCGGCCTCGCCGACCTCATGGGg
10.846NO
27hsa-miR-125b21332151-13.82121
aGUGUU-CAAUCCCAGAGUCCCu
|| || || ||| ||:|||
gCAAAATGT--GGG--TCGGGGc
10.846NO
28hsa-miR-12729402960-18.7121
ucGGUUCGAGUCUGCCUAGGCu
||::|: | | ||: |||
ctCCGGGTGC-GCGGGGGCCGt
5.000NO
29hsa-miR-128a26182641-13.9121
uuuucuCUGGC--CAAGUGA-CACu
|:||| | |||| |||
cgcttcGGCCGCAG-CCACTCGTGg
5.472NO
30hsa-miR-128b26182641-13.9121
cuuucuCUGGC--CAAGUGA-CACu
|:||| | |||| |||
cgcttcGGCCGCAG-CCACTCGTGg
5.226NO
31hsa-miR-133a54985519-20.2121
ugUCGACCAACUUCCCCUG--GUU
| ||||||||| |||| |||
ttACCTGGTTGAA--GGACAGCAA
5.000NO
32hsa-miR-13644204443-12.2121
AGGUAGUAGUUUUGU-UUACCUCa
||| ||| | ||||| | ||||
TCCCTCACCCAAACATACAGGAGa
7.279NO
33hsa-miR-13660086036-14.1121
AGGUAGUAGU-UUUGU-----UUACCUCa
||::||| || :::|| |:|||:|
TCTGTCACCAGGGGCACTGGTAGTGGGGg
7.279NO
34hsa-miR-14169516971-15.9121
gGUAGAAAUGGUCUGUC-ACAau
|||| |:|||| ||| |||
tCATC--TGCCAGTCAGTTGTca
5.100NO
35hsa-miR-14138983918-13.4121
GGUAGAAAUGGUCUGUCACAAu
|::||| ||| | ::|||||
CTGTCTGCACCCG-TGGTGTTg
5.100NO
36hsa-miR-14548044827-13.7121
uucccuaAGGACCCUUUUGACCug
|| ||| ::|||||
gtcaacgTCGTGGCCGGACTGGta
11.062NO
37hsa-miR-146a25152539-14.9121
uUGGGUACCUUAA--GUC-AAGAGu
|::| ||| : | ||| |||||
tATTCCTGGTGCTGGCAGATTCTCg
NONO
38hsa-miR-146b15171547-13.7121
UCGG---AUACC------UUAAGUCAAGAGu
|||| | ||| :| | ||||||
AGCCACGTCTGGTCTCGTGAGCCTGTTCTCc
NONO
39hsa-miR-14786828698-12.1121
CGUCUUCGUAAAGGUGUGug
| ||| | | ||:|||
GGAGACGAA---CCGCACcc
5.000NO
40hsa-miR-14990879116-15.42121
CCU--CAC----UUCUGUG--CCUCGGucu
||| ||| |:|| || ||:|||
GGAGCGTGCCTCAGGAAACTTGGGGCCcct
5.000NO
41hsa-miR-14966806703-12.8121
ccUCAC---UUCUGUGCCUCGGUCu
|||| | || || |||:|
caAGTGCCCCTGTCA-GGTGCCGGc
5.000NO
42hsa-miR-14967296757-19.7121
CCUCACUUC--UGUG--C---CUCGGUCU
|| ||||:| |||| | | |||||
GGCGTGAGGTTACACAGGTACGCCCCAGA
5.000NO
43hsa-miR-14983398368-13.31121
CCUCACUUCUGUG-------C-CUCGGUCU
||||| | |:|| | |||::|||
GGAGTCTATATACCAATGCTGCGAGTTAGA
5.000NO
44hsa-miR-15a11191146-13.8121
GUGU--UUG--GUAAUA--CACGACGau
|||| :|| ||| :| | |||||
CACATCGACCTCATGGTTGGCGCTGCcg
9.991NO
45hsa-miR-15b11211146-12.8121
acAUUUG--GUACUA--CACGACGau
| :|| ||||:| | |||||
caTCGACCTCATGGTTGGCGCTGCcg
9.090NO
46hsa-miR-15b52785304-13.7121
aCAUUUGGUACU--AC--AC-GACGau
||| |:||||: || || ||||
aGTACATCATGGCCTGCATGTCTGCcg
9.090NO
47hsa-miR-17-5p20942121-14.6121
uGAUGG---ACG-UGACAUUCGUGaaac
||||| ||| | | ||||||
cCTACCGATTGCTTCCGGAAGCACccgg
8.771NO
48hsa-miR-181b34893512-17.8121
GGGUGGCUGUCGU--UACUUACaa
|:|||||:| |:: | |||||
CTCACCGGCCGTGACAAGAATGag
6.484NO
49hsa-miR-181b64976524-17.8121
GG-GUGGCUGUCGUU-----ACUUACaa
|| |||| :|||||| |||||
CCGCACCTGCAGCAACGTATGGAATGgc
6.484NO
50hsa-miR-181c81058132-13121
uGAGUGGC---U-GUCC--AACUUACAa
|| |:|| | | || |||:|||
gCTGATCGTGTACCCGGACCTGAGTGTc
8.945NO
miR-7
Target on hcv 11a 
Binding site 3625-3646
mfe : -12.9
Hybrid sequence
guuGUUUUAGUGAUCAGAAGGU
ggcCCAGGGGGCCCGTCTGCCA let-7a
Target on hcv 11a 
Binding site 3032-3054
mfe : -12.7
Hybrid sequence
uugaUAUGUUGGAUG--AUGGAGu
attgATAGGACC-GCTGTACCTCc let-7b
Target on hcv 11a 
Binding site 1786-1809
mfe : -15.3
Hybrid sequence
UUGGUGUGUUGG--AUGAUGGagu
AGCCTTACTGCTGGCACTACCcgc let-7b
Target on hcv 11a 
Binding site 2080-2102
mfe : -12.52
Hybrid sequence
UUGGUG-UGUUGGAUGAUGGagu
AAACGCTGCGATGTCCTACCgat let-7c
Target on hcv 11a 
Binding site 3032-3054
mfe : -12.6
Hybrid sequence
uuggUAUGUUGGAUG--AUGGAGu
attgATAGGACC-GCTGTACCTCc let-7c
Target on hcv 11a 
Binding site 9187-9207
mfe : -14.3
Hybrid sequence
uuggUAUGUUGGAUGAUGGAGu
ctatATGCGGCAT-GTACCTCt let-7d
Target on hcv 11a 
Binding site 4123-4155
mfe : -14.8
Hybrid sequence
ugauACGUUGG-----------AUG-AUGGAGa
tggcTGCAACCCTGTCCTTTGGTTCATACCTCa let-7e
Target on hcv 11a 
Binding site 9245-9267
mfe : -16.8
Hybrid sequence
UGAUAUGUUG-GAG-GAUGGAGu
ATTGCGCGACGCTCACCGCCTCg let-7g
Target on hcv 11a 
Binding site 5105-5130
mfe : -13.5
Hybrid sequence
uGA-CAU-GUUUGAU--GAUGG-AGu
cCTGGTAGCCTACCAGGCTACCGTCt let-7g
Target on hcv 11a 
Binding site 8438-8463
mfe : -12.8
Hybrid sequence
UGACAU-GUU----UGAUGAUGGAGu
ACAGGGTCAATCCTGCGGCTACCGCc let-7i
Target on hcv 11a 
Binding site 2258-2282
mfe : -16.7
Hybrid sequence
ugUCGUGUU----UGAUGAUGGAgu
tgAGCATAGGTTCACGGCTGCCTgc let-7i
Target on hcv 11a 
Binding site 9245-9267
mfe : -15.8
Hybrid sequence
UGUCGUGUU-UGA-UGAUGGAGu
ATTGCGCGACGCTCACCGCCTCg miR-103
Target on hcv 11a 
Binding site 5840-5864
mfe : -12.5
Hybrid sequence
aguAUCG--GGACAUGUUACGACGA
ggtTAGCGGCTTAGCCGGCGCTGCT miR-106a
Target on hcv 11a 
Binding site 2094-2121
mfe : -13.46
Hybrid sequence
cGAUGG---ACG-UGACAUUCGUGaaaa
cCTACCGATTGCTTCCGGAAGCACccgg miR-106a
Target on hcv 11a 
Binding site 6005-6028
mfe : -13.2
Hybrid sequence
cGAUGGAC-GUGACAUUCGUGAaaa
cCT-TCTGTCACCAGGGGCACTggt miR-106a
Target on hcv 11a 
Binding site 1189-1217
mfe : -13.7
Hybrid sequence
cGAUGGA------CG-UGACAUUCGUGAAAA
tCTTCCTGGTAGGGCAACTCTT--CACTTTT miR-107
Target on hcv 11a 
Binding site 4570-4595
mfe : -12.6
Hybrid sequence
ACUAUCGGGACAU---GUUACGACga
TGAGAACTCTGGGCCTCAATGCCGtc miR-107
Target on hcv 11a 
Binding site 8417-8454
mfe : -20.24
Hybrid sequence
aCUAUCGGG--ACAU-------------GUUACGACGa
gGGAGGCCCTATGTACAATTCACAGGGTCAATCCTGCg miR-107
Target on hcv 11a 
Binding site 8803-8819
mfe : -15.5
Hybrid sequence
acuAUCGGGACAUGUUACGACGA
tccTAGCCCGG------GCTGCT miR-122a
Target on hcv 11a 
Binding site 4428-4453
mfe : -13.1
Hybrid sequence
uGUUUGUG-GU-AACAG-UGUGAGGu
cCAAACATACAGGAGACGGCACTTCc miR-124a
Target on hcv 11a 
Binding site 196-220
mfe : -12.8
Hybrid sequence
ACCGUAAGU--GGCG---CACGGAauu
TGG-A-TCAACCCGCTCAATGCCTgga miR-124a
Target on hcv 11a 
Binding site 4363-4381
mfe : -12.4
Hybrid sequence
acCGUAAGUGGCGCACGGAAUu
caGCA--GGCTGC-CGCCTTAc miR-125a
Target on hcv 11a 
Binding site 720-743
mfe : -14.7
Hybrid sequence
guGUCCAAUUUCCCAGAGU-CCCu
tgCGGCCTCGCCGACCTCATGGGg miR-125a
Target on hcv 11a 
Binding site 2126-2151
mfe : -12.6
Hybrid sequence
GUG--UCCAAUUU---CCCAGAGUCCCu
CACTTATGCAAAATGTGGG--TCGGGGc miR-125a
Target on hcv 11a 
Binding site 5002-5026
mfe : -13.1
Hybrid sequence
guGUCCAAUU---UCCCAGAGUCCCU
gcCAGGATCATCTAGAG-TTCTGGGA miR-125b
Target on hcv 11a 
Binding site 719-743
mfe : -14.7
Hybrid sequence
AGUGUUCAAUC--CCAGAGU-CCCu
TTGCGGCCTCGCCGACCTCATGGGg miR-125b
Target on hcv 11a 
Binding site 2133-2151
mfe : -13.82
Hybrid sequence
aGUGUU-CAAUCCCAGAGUCCCu
gCAAAATGT--GGG--TCGGGGc miR-127
Target on hcv 11a 
Binding site 2940-2960
mfe : -18.7
Hybrid sequence
ucGGUUCGAGUCUGCCUAGGCu
ctCCGGGTGC-GCGGGGGCCGt miR-128a
Target on hcv 11a 
Binding site 2618-2641
mfe : -13.9
Hybrid sequence
uuuucuCUGGC--CAAGUGA-CACu
cgcttcGGCCGCAG-CCACTCGTGg miR-128b
Target on hcv 11a 
Binding site 2618-2641
mfe : -13.9
Hybrid sequence
cuuucuCUGGC--CAAGUGA-CACu
cgcttcGGCCGCAG-CCACTCGTGg miR-133a
Target on hcv 11a 
Binding site 5498-5519
mfe : -20.2
Hybrid sequence
ugUCGACCAACUUCCCCUG--GUU
ttACCTGGTTGAA--GGACAGCAA miR-136
Target on hcv 11a 
Binding site 4420-4443
mfe : -12.2
Hybrid sequence
AGGUAGUAGUUUUGU-UUACCUCa
TCCCTCACCCAAACATACAGGAGa miR-136
Target on hcv 11a 
Binding site 6008-6036
mfe : -14.1
Hybrid sequence
AGGUAGUAGU-UUUGU-----UUACCUCa
TCTGTCACCAGGGGCACTGGTAGTGGGGg miR-141
Target on hcv 11a 
Binding site 6951-6971
mfe : -15.9
Hybrid sequence
gGUAGAAAUGGUCUGUC-ACAau
tCATC--TGCCAGTCAGTTGTca miR-141
Target on hcv 11a 
Binding site 3898-3918
mfe : -13.4
Hybrid sequence
GGUAGAAAUGGUCUGUCACAAu
CTGTCTGCACCCG-TGGTGTTg miR-145
Target on hcv 11a 
Binding site 4804-4827
mfe : -13.7
Hybrid sequence
uucccuaAGGACCCUUUUGACCug
gtcaacgTCGTGGCCGGACTGGta miR-146a
Target on hcv 11a 
Binding site 2515-2539
mfe : -14.9
Hybrid sequence
uUGGGUACCUUAA--GUC-AAGAGu
tATTCCTGGTGCTGGCAGATTCTCg miR-146b
Target on hcv 11a 
Binding site 1517-1547
mfe : -13.7
Hybrid sequence
UCGG---AUACC------UUAAGUCAAGAGu
AGCCACGTCTGGTCTCGTGAGCCTGTTCTCc miR-147
Target on hcv 11a 
Binding site 8682-8698
mfe : -12.1
Hybrid sequence
CGUCUUCGUAAAGGUGUGug
GGAGACGAA---CCGCACcc miR-149
Target on hcv 11a 
Binding site 9087-9116
mfe : -15.42
Hybrid sequence
CCU--CAC----UUCUGUG--CCUCGGucu
GGAGCGTGCCTCAGGAAACTTGGGGCCcct miR-149
Target on hcv 11a 
Binding site 6680-6703
mfe : -12.8
Hybrid sequence
ccUCAC---UUCUGUGCCUCGGUCu
caAGTGCCCCTGTCA-GGTGCCGGc miR-149
Target on hcv 11a 
Binding site 6729-6757
mfe : -19.7
Hybrid sequence
CCUCACUUC--UGUG--C---CUCGGUCU
GGCGTGAGGTTACACAGGTACGCCCCAGA miR-149
Target on hcv 11a 
Binding site 8339-8368
mfe : -13.31
Hybrid sequence
CCUCACUUCUGUG-------C-CUCGGUCU
GGAGTCTATATACCAATGCTGCGAGTTAGA miR-15a
Target on hcv 11a 
Binding site 1119-1146
mfe : -13.8
Hybrid sequence
GUGU--UUG--GUAAUA--CACGACGau
CACATCGACCTCATGGTTGGCGCTGCcg miR-15b
Target on hcv 11a 
Binding site 1121-1146
mfe : -12.8
Hybrid sequence
acAUUUG--GUACUA--CACGACGau
caTCGACCTCATGGTTGGCGCTGCcg miR-15b
Target on hcv 11a 
Binding site 5278-5304
mfe : -13.7
Hybrid sequence
aCAUUUGGUACU--AC--AC-GACGau
aGTACATCATGGCCTGCATGTCTGCcg miR-17-5p
Target on hcv 11a 
Binding site 2094-2121
mfe : -14.6
Hybrid sequence
uGAUGG---ACG-UGACAUUCGUGaaac
cCTACCGATTGCTTCCGGAAGCACccgg miR-181b
Target on hcv 11a 
Binding site 3489-3512
mfe : -17.8
Hybrid sequence
GGGUGGCUGUCGU--UACUUACaa
CTCACCGGCCGTGACAAGAATGag miR-181b
Target on hcv 11a 
Binding site 6497-6524
mfe : -17.8
Hybrid sequence
GG-GUGGCUGUCGUU-----ACUUACaa
CCGCACCTGCAGCAACGTATGGAATGgc miR-181c
Target on hcv 11a 
Binding site 8105-8132
mfe : -13
Hybrid sequence
uGAGUGGC---U-GUCC--AACUUACAa
gCTGATCGTGTACCCGGACCTGAGTGTc