Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV 10a target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 3492 rescords (70 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a12521270-14.7121
UUGAUAUGUUGGAUGAUGGagu
||||:| |:|: |||||
AACTGTTCGAT---CTACCctg
11.678NO
2hsa-let-7b21772200-12.5121
uuggugUGUUGG--AUGAUGGAGu
|| ||| ||| :||||
tggttgACTACCCGTACCGCCTCt
11.726NO
3hsa-let-7b82758296-15.9121
uuGGUGUGUUGGAUGAUGGAGu
|:|:: ||| :||:|:||
tcCTATGACACCCGCTGCTTCg
11.726NO
4hsa-let-7b77187741-17.2121
uUGGUGUGUUGGA--UGAUGGAGU
|| |||||:|| ||||: ||
gACACCACAATCTTGTCTACTCCA
11.726NO
5hsa-let-7b80138038-16.7121
uUGGUGUG--U-UGGAUGAUGG-AGU
||:|||| | ||| || ||| |||
cACTACACCTATACCAACCACCATCA
11.726NO
6hsa-let-7b86698687-19.2121
uuGGUGUGUUGGAUGAUGGAGU
||| :|:|| | :|||||
ctCCAGGCGAC---CCGCCTCA
11.726NO
7hsa-let-7c83388359-17.3121
UUGGUAUGUUGGAUGAUGGAGU
| |:|| ::|||:: ||||||
ATCTATCAGGCCTGTGACCTCA
11.774NO
8hsa-let-7c86698687-17.1121
uuGGUAUGUUGGAUGAUGGAGU
||| :|:|| | :|||||
ctCCAGGCGAC---CCGCCTCA
11.774NO
9hsa-let-7e83398359-17121
uGAUAUGUUGGAGGAUGGAGU
|||| ::||| : ||||||
tCTATCAGGCCTGTGACCTCA
6.037NO
10hsa-let-7i61396160-16.2121
ugUCGUGUUUGA-UGAUGGAGu
||||| |||| ||||: ||
gtAGCACCAACTCACTATGTCc
7.883NO
11hsa-miR-10189558976-13.5121
GAAG-UCAAUAGUGUCAUGACAu
|||| || |:| ||:| :||||
CTTCGAGATGT-ACGGGGCTGTc
9.992NO
12hsa-miR-10381110-15.3121
aGUAUCGGGA-CAUGU------UACGACGa
|||:|| :| ||||: :||| ||
cCATGGCGTTAGTACGAGTGTCGTGCAGCc
9.493NO
13hsa-miR-10528122834-17.7121
uGUCCUCA-GACUCG--UAAACu
| ||||| |||||| :||||
gCCGGAGTGCTGAGCTTGTTTGc
5.000NO
14hsa-miR-10740964118-15.9121
aCUAUCGGGACAUG-UUACGACga
|:|| || ||:| :|||||
gGGTATACC-GTGCTTGTGCTGaa
9.255NO
15hsa-miR-10721242146-15121
aCUAUCGGGACAUGUUA-CGACGa
||| ||| |||||| |:|||
cGAT-GCCACCTACAATCGTTGCg
9.255NO
16hsa-miR-10a59735994-13.7121
guGUUUAAGCCUAGAUGUCCCAU
| |: |||| ||| ||||
gcCCAGCACGGA-GGACATGGTA
7.071NO
17hsa-miR-124a39133934-14.4121
aCCGUAAGUGGCGCACGGAAUu
|| :| :: || ||||||
aGGGGTGTGGCGAAGGCCTTAc
5.000NO
18hsa-miR-125a59105930-22.6121
guGUCCAAUUUCCCAGAGUCCCu
||||||| :||| || :|||
ggCAGGTTATGGGG-CT-GGGGt
10.086NO
19hsa-miR-125b20972117-12.1121
AGUGUUCAAUCCCAGAGUCCcu
|| || | | ||:|||||
TCCCACG-GACTGTTTCAGGaa
10.846NO
20hsa-miR-12723032325-12.8121
UCG----GUUCGAGUCUGCCUAGGCu
||| ||| || :|| ||| |||
AGCGTTGCAACCT-GGA-GGA-CCGg
5.000NO
21hsa-miR-12737163737-15.32121
uCGGUUCGAGUCUGCCUAGGCu
|||: || |: :||| || |
tGCCGTGCACGTGCGGCTCAGc
5.000NO
22hsa-miR-128b10631084-12.5121
CUUUC--UCUGGCCAAGUGACACU
| ||| |||| ||:| ||||
GTAAGCCCTACCG--TCGCCGTGA
5.226NO
23hsa-miR-130b26632687-15.02121
uACGGGAAA-GUA--GUAACGUGac
||||:||| |:| | | ||||
tTGCCTTTTGCGTTGCTTGGCACgt
5.095NO
24hsa-miR-13236663689-15.12121
gCUGGUACCGA--CAUCUGACaau
||||| | || || |:|||
aGACCAGGACTTGGTCGGCTGgcc
5.000NO
25hsa-miR-13271527178-12.7121
GCU----GGU-ACCGACAUCUGACAAu
||| :|| | |||| || ||||
CGAGCTCTCAGTAGCTGCTGAGTGTTt
5.000NO
26hsa-miR-133a24732498-17.4121
uGUC--GACCAACUUCCCC--UGGUU
||| ||||| |: ||| |:|||
tCAGGTCTGGTGGGCTGGGCAATCAA
5.000NO
27hsa-miR-133a91509179-15.84121
UGUCGACCAA------CUUCCC--CUGGUU
| |||| || |:|||| |:||||
AAAGCTCATTTCCCAGGGAGGGAAGGCCAA
5.000NO
28hsa-miR-133b66316651-12.1121
aucgaccaaCUUCCCCUGguu
| :||||||
gtacgcaaaGTGGGGGACttc
NONO
29hsa-miR-13432713289-12.9121
GGGAGACCAGUUG--GUCAGugu
||| |||| | |||||
CCC----GTCATCTTCAGTCcta
5.000NO
30hsa-miR-13434263451-14.1121
gggaGAC--CAGUUG--GUC-AGUGu
||| | |:|: ||| ||||
gttgCTGGCGCCGATAACAGCTCACg
5.000NO
31hsa-miR-13447674788-12.72121
gggagaccaGUUG-GUCAGUGu
| || ||||| |
tattgagacCCACACAGTCCCt
5.000NO
32hsa-miR-13470047026-13.4121
GGGAGAC--CAGUUGGUCAGUGu
| | | | | || |||| |:|
CGCACGGACGGCATCCAGACGCt
5.000NO
33hsa-miR-13438413859-15.6121
ggGAGACCAGUUGGUCAGUGU
|||| ||:: |:||| ||
ggCTCT--TCGGGCGGTCCCA
5.000NO
34hsa-miR-13475047523-18.1121
ggGAGACCAGUUGGUCAGUGU
||| || |||| |||| ||
gaCTC-GGACAACGAGTCTCA
5.000NO
35hsa-miR-135a6285-14.7121
AGUGUAUCCUUAUUU--UUCGGUAu
||||: |||| : : ||||||
TCACG-CGGAAAGCGTCTAGCCATg
NONO
36hsa-miR-14536063631-13.4121
uuccCUAAGGACCCUU--UUGACCug
|:|||: || | |:||||
agctGGTTCTAGGACATTAGCTGGta
11.062NO
37hsa-miR-14780018022-12.3121
CG-UCUUC-GUAAAGGUGUGug
|| :|||| || |:||||
GCTGGAAGACAACACTACACct
5.000NO
38hsa-miR-14970817101-15.8121
cCUCACUUCUGUGCCUC-GGUcu
|:|||:|| | | ||| |||
cGGGTGGAGTC-C-GAGTCCAag
5.000NO
39hsa-miR-14960376067-15.4121
CCUCACU-------UC--UGUGCCUCGGUCu
|| |||| || |: | | |||:|
GGCGTGATCTGCGCAGCTATTCTGCGCCGGc
5.000NO
40hsa-miR-14974317458-18.6121
CCUC--ACUUCUGUG----CCUCGGUCu
|||| |||: ::|| ||:|:|:|
GGAGGATGAGAGTACCTCAGGGGTCGGc
5.000NO
41hsa-miR-15028512872-17.1121
GUGACCAUGUUCCCAACCcucu
| ||||||:||| ||||
CCCTGGTATAAGCATTGGatag
7.336NO
42hsa-miR-15032903317-13.22121
gugaCCAUGUUCC-------CAACCCUCu
||| :|||| | |||||
tggaGGT-TAAGGTTATTACATGGGGAGc
7.336NO
43hsa-miR-15174457470-19.1121
GGAGUUCC---UCG-AAGUCAGAUCa
|||||:|| :|| ||| |||:|
CCTCAGGGGTCGGCACTCAATCTGGc
NONO
44hsa-miR-15282858312-12.3121
GGGU-UCAAGAC--A-GU-AC-GUGACU
|||: | |: | | || || ||||||
CCCGCTGCTTCGACTCCACTGTCACTGA
7.093NO
45hsa-miR-15414811505-14.7121
gCUUCCG-UUGUGC--CUAUUGgau
|:| || |:|||| ||||||
tGGACGCTAGCACGACGATAACtgg
5.000NO
46hsa-miR-17-3p45814601-15.1121
UG-UUCACGGAAGUGACGUCa
|| ::| |:| |:|||:||
ACTGGGCGTCAACGCTGTAGc
6.278NO
47hsa-miR-17-3p54485467-12.8121
UGUUCACGGAAGUGACGUCA
| ||||||: | | |||||
AGAAGTGCTATACCAGCAGT
6.278NO
48hsa-miR-17-5p26202643-15.26121
uGAUGGACGUGACAUUCGUGaaac
| |:|| |:||| ::||||
gCCATCTCCGCTGCGGGCACacat
8.771NO
49hsa-miR-18a*58685892-14121
uCUUCC-UCGU-----GAAUCCCGUca
| ||| |||| || |||||
tGTAGGAAGCATCGGCCT--GGGCAag
NONO
50hsa-miR-18b57235744-12121
AUUGACGUGAUCUACGUGGAau
| |: |||:| ||||:||
TCATGGCATTTACTGCATCTgt
NONO
let-7a
Target on hcv 10a 
Binding site 1252-1270
mfe : -14.7
Hybrid sequence
UUGAUAUGUUGGAUGAUGGagu
AACTGTTCGAT---CTACCctg let-7b
Target on hcv 10a 
Binding site 2177-2200
mfe : -12.5
Hybrid sequence
uuggugUGUUGG--AUGAUGGAGu
tggttgACTACCCGTACCGCCTCt let-7b
Target on hcv 10a 
Binding site 8275-8296
mfe : -15.9
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGu
tcCTATGACACCCGCTGCTTCg let-7b
Target on hcv 10a 
Binding site 7718-7741
mfe : -17.2
Hybrid sequence
uUGGUGUGUUGGA--UGAUGGAGU
gACACCACAATCTTGTCTACTCCA let-7b
Target on hcv 10a 
Binding site 8013-8038
mfe : -16.7
Hybrid sequence
uUGGUGUG--U-UGGAUGAUGG-AGU
cACTACACCTATACCAACCACCATCA let-7b
Target on hcv 10a 
Binding site 8669-8687
mfe : -19.2
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGU
ctCCAGGCGAC---CCGCCTCA let-7c
Target on hcv 10a 
Binding site 8338-8359
mfe : -17.3
Hybrid sequence
UUGGUAUGUUGGAUGAUGGAGU
ATCTATCAGGCCTGTGACCTCA let-7c
Target on hcv 10a 
Binding site 8669-8687
mfe : -17.1
Hybrid sequence
uuGGUAUGUUGGAUGAUGGAGU
ctCCAGGCGAC---CCGCCTCA let-7e
Target on hcv 10a 
Binding site 8339-8359
mfe : -17
Hybrid sequence
uGAUAUGUUGGAGGAUGGAGU
tCTATCAGGCCTGTGACCTCA let-7i
Target on hcv 10a 
Binding site 6139-6160
mfe : -16.2
Hybrid sequence
ugUCGUGUUUGA-UGAUGGAGu
gtAGCACCAACTCACTATGTCc miR-101
Target on hcv 10a 
Binding site 8955-8976
mfe : -13.5
Hybrid sequence
GAAG-UCAAUAGUGUCAUGACAu
CTTCGAGATGT-ACGGGGCTGTc miR-103
Target on hcv 10a 
Binding site 81-110
mfe : -15.3
Hybrid sequence
aGUAUCGGGA-CAUGU------UACGACGa
cCATGGCGTTAGTACGAGTGTCGTGCAGCc miR-105
Target on hcv 10a 
Binding site 2812-2834
mfe : -17.7
Hybrid sequence
uGUCCUCA-GACUCG--UAAACu
gCCGGAGTGCTGAGCTTGTTTGc miR-107
Target on hcv 10a 
Binding site 4096-4118
mfe : -15.9
Hybrid sequence
aCUAUCGGGACAUG-UUACGACga
gGGTATACC-GTGCTTGTGCTGaa miR-107
Target on hcv 10a 
Binding site 2124-2146
mfe : -15
Hybrid sequence
aCUAUCGGGACAUGUUA-CGACGa
cGAT-GCCACCTACAATCGTTGCg miR-10a
Target on hcv 10a 
Binding site 5973-5994
mfe : -13.7
Hybrid sequence
guGUUUAAGCCUAGAUGUCCCAU
gcCCAGCACGGA-GGACATGGTA miR-124a
Target on hcv 10a 
Binding site 3913-3934
mfe : -14.4
Hybrid sequence
aCCGUAAGUGGCGCACGGAAUu
aGGGGTGTGGCGAAGGCCTTAc miR-125a
Target on hcv 10a 
Binding site 5910-5930
mfe : -22.6
Hybrid sequence
guGUCCAAUUUCCCAGAGUCCCu
ggCAGGTTATGGGG-CT-GGGGt miR-125b
Target on hcv 10a 
Binding site 2097-2117
mfe : -12.1
Hybrid sequence
AGUGUUCAAUCCCAGAGUCCcu
TCCCACG-GACTGTTTCAGGaa miR-127
Target on hcv 10a 
Binding site 2303-2325
mfe : -12.8
Hybrid sequence
UCG----GUUCGAGUCUGCCUAGGCu
AGCGTTGCAACCT-GGA-GGA-CCGg miR-127
Target on hcv 10a 
Binding site 3716-3737
mfe : -15.32
Hybrid sequence
uCGGUUCGAGUCUGCCUAGGCu
tGCCGTGCACGTGCGGCTCAGc miR-128b
Target on hcv 10a 
Binding site 1063-1084
mfe : -12.5
Hybrid sequence
CUUUC--UCUGGCCAAGUGACACU
GTAAGCCCTACCG--TCGCCGTGA miR-130b
Target on hcv 10a 
Binding site 2663-2687
mfe : -15.02
Hybrid sequence
uACGGGAAA-GUA--GUAACGUGac
tTGCCTTTTGCGTTGCTTGGCACgt miR-132
Target on hcv 10a 
Binding site 3666-3689
mfe : -15.12
Hybrid sequence
gCUGGUACCGA--CAUCUGACaau
aGACCAGGACTTGGTCGGCTGgcc miR-132
Target on hcv 10a 
Binding site 7152-7178
mfe : -12.7
Hybrid sequence
GCU----GGU-ACCGACAUCUGACAAu
CGAGCTCTCAGTAGCTGCTGAGTGTTt miR-133a
Target on hcv 10a 
Binding site 2473-2498
mfe : -17.4
Hybrid sequence
uGUC--GACCAACUUCCCC--UGGUU
tCAGGTCTGGTGGGCTGGGCAATCAA miR-133a
Target on hcv 10a 
Binding site 9150-9179
mfe : -15.84
Hybrid sequence
UGUCGACCAA------CUUCCC--CUGGUU
AAAGCTCATTTCCCAGGGAGGGAAGGCCAA miR-133b
Target on hcv 10a 
Binding site 6631-6651
mfe : -12.1
Hybrid sequence
aucgaccaaCUUCCCCUGguu
gtacgcaaaGTGGGGGACttc miR-134
Target on hcv 10a 
Binding site 3271-3289
mfe : -12.9
Hybrid sequence
GGGAGACCAGUUG--GUCAGugu
CCC----GTCATCTTCAGTCcta miR-134
Target on hcv 10a 
Binding site 3426-3451
mfe : -14.1
Hybrid sequence
gggaGAC--CAGUUG--GUC-AGUGu
gttgCTGGCGCCGATAACAGCTCACg miR-134
Target on hcv 10a 
Binding site 4767-4788
mfe : -12.72
Hybrid sequence
gggagaccaGUUG-GUCAGUGu
tattgagacCCACACAGTCCCt miR-134
Target on hcv 10a 
Binding site 7004-7026
mfe : -13.4
Hybrid sequence
GGGAGAC--CAGUUGGUCAGUGu
CGCACGGACGGCATCCAGACGCt miR-134
Target on hcv 10a 
Binding site 3841-3859
mfe : -15.6
Hybrid sequence
ggGAGACCAGUUGGUCAGUGU
ggCTCT--TCGGGCGGTCCCA miR-134
Target on hcv 10a 
Binding site 7504-7523
mfe : -18.1
Hybrid sequence
ggGAGACCAGUUGGUCAGUGU
gaCTC-GGACAACGAGTCTCA miR-135a
Target on hcv 10a 
Binding site 62-85
mfe : -14.7
Hybrid sequence
AGUGUAUCCUUAUUU--UUCGGUAu
TCACG-CGGAAAGCGTCTAGCCATg miR-145
Target on hcv 10a 
Binding site 3606-3631
mfe : -13.4
Hybrid sequence
uuccCUAAGGACCCUU--UUGACCug
agctGGTTCTAGGACATTAGCTGGta miR-147
Target on hcv 10a 
Binding site 8001-8022
mfe : -12.3
Hybrid sequence
CG-UCUUC-GUAAAGGUGUGug
GCTGGAAGACAACACTACACct miR-149
Target on hcv 10a 
Binding site 7081-7101
mfe : -15.8
Hybrid sequence
cCUCACUUCUGUGCCUC-GGUcu
cGGGTGGAGTC-C-GAGTCCAag miR-149
Target on hcv 10a 
Binding site 6037-6067
mfe : -15.4
Hybrid sequence
CCUCACU-------UC--UGUGCCUCGGUCu
GGCGTGATCTGCGCAGCTATTCTGCGCCGGc miR-149
Target on hcv 10a 
Binding site 7431-7458
mfe : -18.6
Hybrid sequence
CCUC--ACUUCUGUG----CCUCGGUCu
GGAGGATGAGAGTACCTCAGGGGTCGGc miR-150
Target on hcv 10a 
Binding site 2851-2872
mfe : -17.1
Hybrid sequence
GUGACCAUGUUCCCAACCcucu
CCCTGGTATAAGCATTGGatag miR-150
Target on hcv 10a 
Binding site 3290-3317
mfe : -13.22
Hybrid sequence
gugaCCAUGUUCC-------CAACCCUCu
tggaGGT-TAAGGTTATTACATGGGGAGc miR-151
Target on hcv 10a 
Binding site 7445-7470
mfe : -19.1
Hybrid sequence
GGAGUUCC---UCG-AAGUCAGAUCa
CCTCAGGGGTCGGCACTCAATCTGGc miR-152
Target on hcv 10a 
Binding site 8285-8312
mfe : -12.3
Hybrid sequence
GGGU-UCAAGAC--A-GU-AC-GUGACU
CCCGCTGCTTCGACTCCACTGTCACTGA miR-154
Target on hcv 10a 
Binding site 1481-1505
mfe : -14.7
Hybrid sequence
gCUUCCG-UUGUGC--CUAUUGgau
tGGACGCTAGCACGACGATAACtgg miR-17-3p
Target on hcv 10a 
Binding site 4581-4601
mfe : -15.1
Hybrid sequence
UG-UUCACGGAAGUGACGUCa
ACTGGGCGTCAACGCTGTAGc miR-17-3p
Target on hcv 10a 
Binding site 5448-5467
mfe : -12.8
Hybrid sequence
UGUUCACGGAAGUGACGUCA
AGAAGTGCTATACCAGCAGT miR-17-5p
Target on hcv 10a 
Binding site 2620-2643
mfe : -15.26
Hybrid sequence
uGAUGGACGUGACAUUCGUGaaac
gCCATCTCCGCTGCGGGCACacat miR-18a*
Target on hcv 10a 
Binding site 5868-5892
mfe : -14
Hybrid sequence
uCUUCC-UCGU-----GAAUCCCGUca
tGTAGGAAGCATCGGCCT--GGGCAag miR-18b
Target on hcv 10a 
Binding site 5723-5744
mfe : -12
Hybrid sequence
AUUGACGUGAUCUACGUGGAau
TCATGGCATTTACTGCATCTgt