Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV 3a target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 3573 rescords (72 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-1127-12121
aUGUAUGAAGAA-------AUGUAAGGU
|| |:| |||| ||| ||||
-ACCTGCCTCTTACGAGGCGACACTCCA
5.340NO
2hsa-miR-916471678-14.6121
aguAUGUCGAUC--------UAUUGGU-UUCu
||:||||:| || |||| |||
gttTATAGCTGGGTTGTTTTATTACCATAAGt
5.114NO
3hsa-let-7b23612387-12.6121
UUGGUGUGUUG---G--AUGAUGGAgu
||| || |:| | ||||:|||
AACAACTGAGCTTGCTATACTGCCTtg
11.726NO
4hsa-let-7b40134042-16.1121
uuGGUGU---GUUGG---AU--GAUGGAGu
||||| | |:| || ||||||
ttCCACAGAGCTATCAAGTAGGATACCTCc
11.726NO
5hsa-let-7b80168044-14.2121
uUGGUGU----GUU--GGAUGAUGG-AGU
|||||| ||| || || ||| |||
cACCACAACTCCAATTCCAACCACCATCA
11.726NO
6hsa-let-7f23642387-12.4121
UUGAUAUG--UUAGAUGAUGGAgu
||||: :| : | ||||:|||
AACTGAGCTTGCTATACTGCCTtg
10.092NO
7hsa-let-7f57245745-13121
uugAUA-UGUUAGAUGAUGGAGU
||| :|: || |||:|:|||
tctTATGGCGTTC-ACTGCTTCA
10.092NO
8hsa-let-7i51435163-15.6121
uguCGUGUUUGAUGAUGGAGU
||:||::|| || || ||
cgcGCGCAGGCTCCTCCCCCA
7.883NO
9hsa-miR-10165166537-13.42121
gaaGUCAAUAGUGUCAUGACAu
|| |: |||:||||| |
taaCATGTGGCACGGTACTTTc
9.992NO
10hsa-miR-10370087032-15.8121
aGUAUCGGGA-CAUGU-UACGACga
||||| ||| | || | ||||
gCATAGGCCTCATCCAGACGCTGag
9.493NO
11hsa-miR-10381110-15.3121
aGUAUCGGGA-CAUGU------UACGACGa
|||:|| :| ||||: :||| ||
cCATGGCGTTAGTACGAGTGTCGTGCAGCc
9.493NO
12hsa-miR-10312401262-15.3121
aguaUCGGGACAUGUUACGA-CGA
|| |||||| | |||| |||
gtccAGACCTGTA-ACTGCTCGCT
9.493NO
13hsa-miR-10388018817-15.9121
aGUAUCGGGACAUGUUACGACGA
| |||||| :||| |||
cCCTAGCCC------GTGCGGCT
9.493NO
14hsa-miR-106a43244353-14121
CGAUGGACG--UGAC----AUUCGUGaaaa
|||||: || |:|| ||:||||
GCTACTAGCATATTGGGTATAGGCACggtc
8.618NO
15hsa-miR-106a25362564-12.1121
CGAUGGACGUG---ACAU---UCGUGAAAa
|| : | |||| |||: || ||||
GCGGAC-GCACGCGTGTGCGTTGCCCTTTg
8.618NO
16hsa-miR-106b17901810-12.72121
uagacgUGACAGUCGUGAaau
|||| ::|||||
gaccatACTGCTGGCACTacg
5.784NO
17hsa-miR-10712401262-15.3121
acuaUCGGGACAUGUUACGA-CGA
|| |||||| | |||| |||
gtccAGACCTGTA-ACTGCTCGCT
9.255NO
18hsa-miR-10b42384269-12.91121
uGUUUAAGCC-----AAGA-----UGUCCCau
|| | ||| |||| ||:|||
cCACCTACGGTAAGTTTCTCGCGGACGGGGgt
6.727NO
19hsa-miR-124a82868303-15.8121
ACCGUAAGUGGCGCACGGAAUU
|| || | |||| |||:||:|
TGACA--C-CCGC-TGCTTTGA
5.000NO
20hsa-miR-125a53255353-16.1121
GUGUCCAAUUUCCCA----GAG--UCCCu
||| | |||| ||| ||||
CACCAGCACCTGGGTGTTGCTCGGAGGGg
10.086NO
21hsa-miR-12745894622-20.2121
uCG-GUU-CGA----GUCUG-----CCUAG-GCU
|| ||| ||| || || ||:|| |||
gGCTCAACGCTGTAGCATACTATAGGGGTCTCGA
5.000NO
22hsa-miR-128a11311155-13.3121
uuuUC-UCUG-GCCAAGUG--ACACu
|| ||:| ||| ||| ||||
attAGTAGGCGCGG-CCACGATGTGc
5.472NO
23hsa-miR-128b11311155-13.3121
cuuUC-UCUG-GCCAAGUG--ACACu
|| ||:| ||| ||| ||||
attAGTAGGCGCGG-CCACGATGTGc
5.226NO
24hsa-miR-128b23142339-13.9121
CUUU--CU-CUGGC-CAAGUGACACU
|| | || ||:|| | |:| ||||
GATATCGAGGATCGTGACCGCAGTGA
5.226NO
25hsa-miR-133a792813-12.3121
uguCG-ACC-AACUUCCCCUGGuu
|| ||| ||| ||| ||
cgcGCATGGCGTGA--GGGCCCtt
5.000NO
26hsa-miR-133a20512077-16121
UGUCG--ACCAAC-UUCCCCU--GGuu
||| | ||| | :|||||| ||
ACATCTATGGGGGCGAGGGGAATCCcc
5.000NO
27hsa-miR-13449514971-13.6121
GGGAGAC-CAGUUGGUCAGUgu
||| ||| | | | ||||:|
CCCGCTGAGACCA-CAGTTAga
5.000NO
28hsa-miR-135a6285-14.7121
AGUGUAUCCUUAUUU--UUCGGUAu
||||: |||| : : ||||||
TCACG-CGGAAAGCGCCTAGCCATg
NONO
29hsa-miR-142-3p31363160-18.8121
AGGUAU--UUCAUCCUUUGUGAUGu
|||:|: |:| :|||||:||| |
TCCGTGATAGGGGGGAAATACTTCc
9.468NO
30hsa-miR-14534763505-13121
uuCCCUAAGGACCCU--U----UUGACCug
|||| | :|| || | :|||||
ttGGGACTATTGTGACTAGCTTGACTGGca
11.062NO
31hsa-miR-14575467569-21.3121
uUCCCUAAGGACCCUUUUGACCUG
||||| | ||| :| | ||||
gAGGGAGAGCCGGGCGACCCGGAC
11.062NO
32hsa-miR-14770087028-14.2121
CGUCUUCGUA-AAGGUGUGUG
||| |:|| | |||| ||:|
GCATAGGCCTCATCCAGACGC
5.000NO
33hsa-miR-15028542875-15.86121
GUGACCAUGUUCCCAACCcucu
| ||||||:||| ||||
CCCTGGTATAAGCATTGGatcg
7.336NO
34hsa-miR-15029482971-13.8121
gUGACCAUGUUCC--CAACCCUcu
||| | ||: || || ||||
tACTCGCACGCGGGAGTAGGGAtg
7.336NO
35hsa-miR-15053255351-13.6121
GUGACCAUGUUCC--CAAC---CCUCu
||| | || || |||| ||||
CACCAGCACCTGGGTGTTGCTCGGAGg
7.336NO
36hsa-miR-15128062827-17121
gGAGUUCCUCGAAGUCAGAUCa
||| || ||| :|||| |
aCTCTTGGCGCTGGGGTCTTGg
NONO
37hsa-miR-15426922720-17.3121
GCUUCCGUUGUGC-------CUAUUGGAU
||::| ||| || |:|:|||||
CGGGGTAAACTCGTCCCGCTGGTGACCTA
5.000NO
38hsa-miR-15a51235143-19121
guGUUUGGUAAUACACGACGau
|||:||| |:||||| ||
acCAAGCCACTGTGTGC-GCcc
9.991NO
39hsa-miR-15b11391162-18121
acauuuGGUACUACAC--GACGau
||| |||||| ||||
gcgcggCCACGATGTGCTCTGCgc
9.090NO
40hsa-miR-17-3p18401869-18.32121
uGUUCACGGAAG----------UGACGuca
||||||:|| | |||||
tCAAGTGTCTGCGGCCCTGTGTACTGCttc
6.278NO
41hsa-miR-181d16701696-12.1121
uuggguggcuGUUG---UUACUUACAa
|||| | ||:||||
accataagttCAACTCTACTGGATGTc
NONO
42hsa-miR-18375037526-12.6121
guCACUUAAGAUG-GUCACGGUAu
| ||:| | || ||| |:|||
agGGGAGTCCGACTCAGAGTCATg
5.000NO
43hsa-miR-18426052630-14121
UGGGAAUAGU-CAA---GAGGCAGgu
| ||| :||| | | | |||||
AACCTGGTCACGCTGAACGCCGTCgc
5.000NO
44hsa-miR-18417491779-18.8121
uGGGAAUAGUC----A----AGAGG-CAGGu
|||||| ||| | || || ||||
cCCCTTAACAGATGCTAACATCACCGGTCCt
5.000NO
45hsa-miR-18710491071-13.1121
GC-CGACGUUGUGU-UCUGUGcu
|| |||| | | || |||||
CGTGCTGGACCCCAGTGACACct
5.000NO
46hsa-miR-18758995924-14.5121
gcCG-AC-GUUG---UGUUCUGUGCu
|| || || | :||:||:|||
ttGCTTGACATCCTGGCAGGATACGg
5.000NO
47hsa-miR-18766116629-17.2121
gCCGACGUUGUGUUCUGUGCu
|||||| | || || :|||
tGGCTGCCA-AC-AGCTACGt
5.000NO
48hsa-miR-18770687086-20.1121
gCCGACGUUGUGUUCUGUGCu
||| ||||||: |||||
gGGCAGCAACAT--TACACGg
5.000NO
49hsa-miR-18914921511-13.4121
UGACUAUAGUCGAGUCAUCCGUG
|| ||| || | |:|| |||||
ACATATACCA-C-CGGT-GGCAC
5.126NO
50hsa-miR-18915751602-16.6121
uGACUA----UAGU---CGAGUCAUCCGUG
|||:| | || |||| || |||||
gCTGGTCAACACCAATGGCTC-GT-GGCAC
5.126NO
miR-1
Target on hcv 3a 
Binding site 1-27
mfe : -12
Hybrid sequence
aUGUAUGAAGAA-------AUGUAAGGU
-ACCTGCCTCTTACGAGGCGACACTCCA miR-9
Target on hcv 3a 
Binding site 1647-1678
mfe : -14.6
Hybrid sequence
aguAUGUCGAUC--------UAUUGGU-UUCu
gttTATAGCTGGGTTGTTTTATTACCATAAGt let-7b
Target on hcv 3a 
Binding site 2361-2387
mfe : -12.6
Hybrid sequence
UUGGUGUGUUG---G--AUGAUGGAgu
AACAACTGAGCTTGCTATACTGCCTtg let-7b
Target on hcv 3a 
Binding site 4013-4042
mfe : -16.1
Hybrid sequence
uuGGUGU---GUUGG---AU--GAUGGAGu
ttCCACAGAGCTATCAAGTAGGATACCTCc let-7b
Target on hcv 3a 
Binding site 8016-8044
mfe : -14.2
Hybrid sequence
uUGGUGU----GUU--GGAUGAUGG-AGU
cACCACAACTCCAATTCCAACCACCATCA let-7f
Target on hcv 3a 
Binding site 2364-2387
mfe : -12.4
Hybrid sequence
UUGAUAUG--UUAGAUGAUGGAgu
AACTGAGCTTGCTATACTGCCTtg let-7f
Target on hcv 3a 
Binding site 5724-5745
mfe : -13
Hybrid sequence
uugAUA-UGUUAGAUGAUGGAGU
tctTATGGCGTTC-ACTGCTTCA let-7i
Target on hcv 3a 
Binding site 5143-5163
mfe : -15.6
Hybrid sequence
uguCGUGUUUGAUGAUGGAGU
cgcGCGCAGGCTCCTCCCCCA miR-101
Target on hcv 3a 
Binding site 6516-6537
mfe : -13.42
Hybrid sequence
gaaGUCAAUAGUGUCAUGACAu
taaCATGTGGCACGGTACTTTc miR-103
Target on hcv 3a 
Binding site 7008-7032
mfe : -15.8
Hybrid sequence
aGUAUCGGGA-CAUGU-UACGACga
gCATAGGCCTCATCCAGACGCTGag miR-103
Target on hcv 3a 
Binding site 81-110
mfe : -15.3
Hybrid sequence
aGUAUCGGGA-CAUGU------UACGACGa
cCATGGCGTTAGTACGAGTGTCGTGCAGCc miR-103
Target on hcv 3a 
Binding site 1240-1262
mfe : -15.3
Hybrid sequence
aguaUCGGGACAUGUUACGA-CGA
gtccAGACCTGTA-ACTGCTCGCT miR-103
Target on hcv 3a 
Binding site 8801-8817
mfe : -15.9
Hybrid sequence
aGUAUCGGGACAUGUUACGACGA
cCCTAGCCC------GTGCGGCT miR-106a
Target on hcv 3a 
Binding site 4324-4353
mfe : -14
Hybrid sequence
CGAUGGACG--UGAC----AUUCGUGaaaa
GCTACTAGCATATTGGGTATAGGCACggtc miR-106a
Target on hcv 3a 
Binding site 2536-2564
mfe : -12.1
Hybrid sequence
CGAUGGACGUG---ACAU---UCGUGAAAa
GCGGAC-GCACGCGTGTGCGTTGCCCTTTg miR-106b
Target on hcv 3a 
Binding site 1790-1810
mfe : -12.72
Hybrid sequence
uagacgUGACAGUCGUGAaau
gaccatACTGCTGGCACTacg miR-107
Target on hcv 3a 
Binding site 1240-1262
mfe : -15.3
Hybrid sequence
acuaUCGGGACAUGUUACGA-CGA
gtccAGACCTGTA-ACTGCTCGCT miR-10b
Target on hcv 3a 
Binding site 4238-4269
mfe : -12.91
Hybrid sequence
uGUUUAAGCC-----AAGA-----UGUCCCau
cCACCTACGGTAAGTTTCTCGCGGACGGGGgt miR-124a
Target on hcv 3a 
Binding site 8286-8303
mfe : -15.8
Hybrid sequence
ACCGUAAGUGGCGCACGGAAUU
TGACA--C-CCGC-TGCTTTGA miR-125a
Target on hcv 3a 
Binding site 5325-5353
mfe : -16.1
Hybrid sequence
GUGUCCAAUUUCCCA----GAG--UCCCu
CACCAGCACCTGGGTGTTGCTCGGAGGGg miR-127
Target on hcv 3a 
Binding site 4589-4622
mfe : -20.2
Hybrid sequence
uCG-GUU-CGA----GUCUG-----CCUAG-GCU
gGCTCAACGCTGTAGCATACTATAGGGGTCTCGA miR-128a
Target on hcv 3a 
Binding site 1131-1155
mfe : -13.3
Hybrid sequence
uuuUC-UCUG-GCCAAGUG--ACACu
attAGTAGGCGCGG-CCACGATGTGc miR-128b
Target on hcv 3a 
Binding site 1131-1155
mfe : -13.3
Hybrid sequence
cuuUC-UCUG-GCCAAGUG--ACACu
attAGTAGGCGCGG-CCACGATGTGc miR-128b
Target on hcv 3a 
Binding site 2314-2339
mfe : -13.9
Hybrid sequence
CUUU--CU-CUGGC-CAAGUGACACU
GATATCGAGGATCGTGACCGCAGTGA miR-133a
Target on hcv 3a 
Binding site 792-813
mfe : -12.3
Hybrid sequence
uguCG-ACC-AACUUCCCCUGGuu
cgcGCATGGCGTGA--GGGCCCtt miR-133a
Target on hcv 3a 
Binding site 2051-2077
mfe : -16
Hybrid sequence
UGUCG--ACCAAC-UUCCCCU--GGuu
ACATCTATGGGGGCGAGGGGAATCCcc miR-134
Target on hcv 3a 
Binding site 4951-4971
mfe : -13.6
Hybrid sequence
GGGAGAC-CAGUUGGUCAGUgu
CCCGCTGAGACCA-CAGTTAga miR-135a
Target on hcv 3a 
Binding site 62-85
mfe : -14.7
Hybrid sequence
AGUGUAUCCUUAUUU--UUCGGUAu
TCACG-CGGAAAGCGCCTAGCCATg miR-142-3p
Target on hcv 3a 
Binding site 3136-3160
mfe : -18.8
Hybrid sequence
AGGUAU--UUCAUCCUUUGUGAUGu
TCCGTGATAGGGGGGAAATACTTCc miR-145
Target on hcv 3a 
Binding site 3476-3505
mfe : -13
Hybrid sequence
uuCCCUAAGGACCCU--U----UUGACCug
ttGGGACTATTGTGACTAGCTTGACTGGca miR-145
Target on hcv 3a 
Binding site 7546-7569
mfe : -21.3
Hybrid sequence
uUCCCUAAGGACCCUUUUGACCUG
gAGGGAGAGCCGGGCGACCCGGAC miR-147
Target on hcv 3a 
Binding site 7008-7028
mfe : -14.2
Hybrid sequence
CGUCUUCGUA-AAGGUGUGUG
GCATAGGCCTCATCCAGACGC miR-150
Target on hcv 3a 
Binding site 2854-2875
mfe : -15.86
Hybrid sequence
GUGACCAUGUUCCCAACCcucu
CCCTGGTATAAGCATTGGatcg miR-150
Target on hcv 3a 
Binding site 2948-2971
mfe : -13.8
Hybrid sequence
gUGACCAUGUUCC--CAACCCUcu
tACTCGCACGCGGGAGTAGGGAtg miR-150
Target on hcv 3a 
Binding site 5325-5351
mfe : -13.6
Hybrid sequence
GUGACCAUGUUCC--CAAC---CCUCu
CACCAGCACCTGGGTGTTGCTCGGAGg miR-151
Target on hcv 3a 
Binding site 2806-2827
mfe : -17
Hybrid sequence
gGAGUUCCUCGAAGUCAGAUCa
aCTCTTGGCGCTGGGGTCTTGg miR-154
Target on hcv 3a 
Binding site 2692-2720
mfe : -17.3
Hybrid sequence
GCUUCCGUUGUGC-------CUAUUGGAU
CGGGGTAAACTCGTCCCGCTGGTGACCTA miR-15a
Target on hcv 3a 
Binding site 5123-5143
mfe : -19
Hybrid sequence
guGUUUGGUAAUACACGACGau
acCAAGCCACTGTGTGC-GCcc miR-15b
Target on hcv 3a 
Binding site 1139-1162
mfe : -18
Hybrid sequence
acauuuGGUACUACAC--GACGau
gcgcggCCACGATGTGCTCTGCgc miR-17-3p
Target on hcv 3a 
Binding site 1840-1869
mfe : -18.32
Hybrid sequence
uGUUCACGGAAG----------UGACGuca
tCAAGTGTCTGCGGCCCTGTGTACTGCttc miR-181d
Target on hcv 3a 
Binding site 1670-1696
mfe : -12.1
Hybrid sequence
uuggguggcuGUUG---UUACUUACAa
accataagttCAACTCTACTGGATGTc miR-183
Target on hcv 3a 
Binding site 7503-7526
mfe : -12.6
Hybrid sequence
guCACUUAAGAUG-GUCACGGUAu
agGGGAGTCCGACTCAGAGTCATg miR-184
Target on hcv 3a 
Binding site 2605-2630
mfe : -14
Hybrid sequence
UGGGAAUAGU-CAA---GAGGCAGgu
AACCTGGTCACGCTGAACGCCGTCgc miR-184
Target on hcv 3a 
Binding site 1749-1779
mfe : -18.8
Hybrid sequence
uGGGAAUAGUC----A----AGAGG-CAGGu
cCCCTTAACAGATGCTAACATCACCGGTCCt miR-187
Target on hcv 3a 
Binding site 1049-1071
mfe : -13.1
Hybrid sequence
GC-CGACGUUGUGU-UCUGUGcu
CGTGCTGGACCCCAGTGACACct miR-187
Target on hcv 3a 
Binding site 5899-5924
mfe : -14.5
Hybrid sequence
gcCG-AC-GUUG---UGUUCUGUGCu
ttGCTTGACATCCTGGCAGGATACGg miR-187
Target on hcv 3a 
Binding site 6611-6629
mfe : -17.2
Hybrid sequence
gCCGACGUUGUGUUCUGUGCu
tGGCTGCCA-AC-AGCTACGt miR-187
Target on hcv 3a 
Binding site 7068-7086
mfe : -20.1
Hybrid sequence
gCCGACGUUGUGUUCUGUGCu
gGGCAGCAACAT--TACACGg miR-189
Target on hcv 3a 
Binding site 1492-1511
mfe : -13.4
Hybrid sequence
UGACUAUAGUCGAGUCAUCCGUG
ACATATACCA-C-CGGT-GGCAC miR-189
Target on hcv 3a 
Binding site 1575-1602
mfe : -16.6
Hybrid sequence
uGACUA----UAGU---CGAGUCAUCCGUG
gCTGGTCAACACCAATGGCTC-GT-GGCAC