Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV 2a target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 3635 rescords (73 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a56515678-12.3121
UUGA--UA--UGUUGGA--UGAUGGAGu
|||| || :|::| | | ||||||
AACTTCATCAGCGGCATTCAATACCTCg
11.678NO
2hsa-let-7a27022723-13.4121
uuGAUAUGUUGGAUGAUGGAGU
|| :| ||:||:| |||||
ccCTTGGCTACTTATTCCCTCA
11.678NO
3hsa-let-7b62286260-16.32121
uUGGUGUGUUG-------GA----UGAUGGAGU
||: |||||| || |||:|| ||
gACTCCACAACTGGATTACTGAAGACTGCCCCA
11.726NO
4hsa-let-7b87508770-14.8121
uuggugUGUUGGAUGAUGGAGU
||| |:|:|| |||||
ctgataACATCTTGCT-CCTCA
11.726NO
5hsa-miR-10032293250-13.9121
guguucaagcCUAGAUGCCCaa
|: ||:||||
ggctgctaatGGCCTGCGGGac
9.137NO
6hsa-miR-10059105927-12.9121
GUGUUCAAGCCUAGAUGCCCaa
|| ::|| :|| |:||||
CA-GGGTATGG---TGCGGGca
9.137NO
7hsa-miR-10069126931-16.9121
GUGUU-CAAGCCUAGAUGCCCaa
|:|:: |||:|| |||||
CGCGGCGTTTGGC---ACGGGgg
9.137NO
8hsa-miR-10110371058-12.3121
gaagucaaUAGUGUCAUGACau
||| |:||:|||
gggaatacATCTCGGTGCTGga
9.992NO
9hsa-miR-10313321358-17.9121
aGUAUCGGGA---CAU--GUUACGACGa
|||: :||| ||| |:|||| ||
cCATGATCCTGGCGTACGCGATGC-GCg
9.493NO
10hsa-miR-10372607283-17.7121
aguauCGG-GACAUGUUACGACGa
||| |||| : |||||
aaccgGCCACTGTTGCGGGCTGCg
9.493NO
11hsa-miR-10548274849-17.5121
uGUCC---UCAGACUCGUAAAcu
|||| || |||:|:||||
gCAGGGGAAGACTGGGTATTTat
5.000NO
12hsa-miR-106a51155140-15.72121
cGAUGGAC--GUGACAUUCGUGAaaa
||||| | :|| ||: ||:||
cCTACCAGGCTACAGTGTGCGCTagg
8.618NO
13hsa-miR-10736393667-12.8121
aCUAUCGGG---ACAU---GUUACGACga
|:| | | |||| ||:|||||
cGGTCACACAGATGTACTCCAGTGCTGag
9.255NO
14hsa-miR-10758455866-18.1121
acuAUCGGGACAUGUUACGACGa
|:|||: ||: :: |||||
cagTGGCCTGGTG-GGGGCTGCc
9.255NO
15hsa-miR-10772607283-17.7121
acuauCGG-GACAUGUUACGACGa
||| |||| : |||||
aaccgGCCACTGTTGCGGGCTGCg
9.255NO
16hsa-miR-10b48234844-15.4121
UGUUUAAGCCAAGAUGUCCCAU
||::: || || |||||
ACGGGCAGGGGAAGACTGGGTA
6.727NO
17hsa-miR-124a32523274-25.32121
ACCGUAAGUGGCG-CACGGAauu
||||: ||:|||: | ||||
TGGCGGTCGCCGTGGAGCCTatc
5.000NO
18hsa-miR-124a85448567-13.5121
accGUAAGUGGCGC--ACGGAAUu
||| | :|:| ||||||
tcaCATGCTATGTGAAAGCCTTAg
5.000NO
19hsa-miR-125a69126931-15.8121
GUGUC-CAAUUUCCCAGAGUCCCu
|:|:| ||| || | |:|||
CGCGGCGTT---TGG-CACGGGGg
10.086NO
20hsa-miR-12649184938-16.1121
cguaauaauGAGUGCCAUGCU
| ||:||||:||
tgcaggggcCGCATGGTATGA
10.720NO
21hsa-miR-12749044929-12.1121
uCGGUU-CGAGUCU--G-CCUAGGCu
|| |: ||| || | ||: |||
tGCGAGTGCTACGATGCAGGGGCCGc
5.000NO
22hsa-miR-128a38663884-15.8121
uuuUCUCUGGCCAAGUGACAcu
||||:|| |:||||
cccAGAGGCC---ACGCTGTcg
5.472NO
23hsa-miR-128b23182341-13121
CUUUCUCUGGC--CAAGUGACAcu
|| |||||| | || |||||
GACAGAGACAGAAGTCAACTGTct
5.226NO
24hsa-miR-128b38663884-15.8121
cuuUCUCUGGCCAAGUGACAcu
||||:|| |:||||
cccAGAGGCC---ACGCTGTcg
5.226NO
25hsa-miR-132937963-14.32121
GCUG--GUACCGAC---AU-CUGACaau
||:| ||||| || | |||||
CGGCTACATGG-TGACCAACGACTGcac
5.000NO
26hsa-miR-133a75167538-17.4121
ugucgaccAACUUCCCCU-GGuu
| ||:||||| ||
gccccctcTCGAGGGGGAGCCtg
5.000NO
27hsa-miR-133a508529-14.5121
uGUCGACCAACUUCCCCUGGUu
|||| ||:| || :|||
cCAGCCACGTGGAAGGCGCCAg
5.000NO
28hsa-miR-133a13771396-12.1121
UGUCGACCAACUUCCCCUGGUu
||| | |||: |||| :||
ACATC--ATTGGCGGGGCTCAt
5.000NO
29hsa-miR-133a72257253-13.5121
UGUCGACCA-------ACUUCCCCUGGUu
|| ||| || ||:| | |:|||
ACCGCTTGTGGAATCGTGGAAGAGGCCAg
5.000NO
30hsa-miR-133a79637983-13.6121
ugUCG-ACCAACUUCCCCUGGUU
||: ||| | |||:|:||
caAGTATGG--GTTTGGGGCTAA
5.000NO
31hsa-miR-133b82168235-18.3121
aUCGACCAACUUCCCCUGguu
|| || ||| ||||:|
cAGGCGG-TGATGGGGGCttc
NONO
32hsa-miR-133b22892305-13.3121
aucGACCAACUUCCCCUGGuu
|| || |||||:|
tcaCTCGT----GGGGATCgt
NONO
33hsa-miR-133b75177538-15.7121
aucgaccAACUUCCCCU-GGuu
| ||:||||| ||
ccccctcTCGAGGGGGAGCCtg
NONO
34hsa-miR-133b79647983-13.7121
aUCG-ACCAACUUCCCCUGGUU
||: ||| | |||:|:||
aAGTATGG--GTTTGGGGCTAA
NONO
35hsa-miR-13443264351-13.3121
GG-GAGACCAGUUG----GUCAGugu
|| :||| | || | |||||
CCATTCTCGGCATCGGAACAGTCctc
5.000NO
36hsa-miR-13452375260-16121
ggGAGACCA--GUUG-GUCAGUGu
||||| | |||| :|||||
ggCTCTGTTACCAACGAGGTCACc
5.000NO
37hsa-miR-13490329052-16.2121
GGGAGACCAGUUGGUCAGUGU
||||: | | |||| ||:|
CCCTTGGACCTCCCAGCCATA
5.000NO
38hsa-miR-14356335662-13.4121
ACUCG----AUGU-CAC---GAAGUAGagu
||:|| ||| ||| |||||||
TGGGCCAAACACATGTGGAACTTCATCagc
10.136NO
39hsa-miR-14756585681-12.6121
cGUCUUCGUAA---A-GGUGUGUg
||| :||||| | || |:||
tCAGCGGCATTCAATACCTCGCAg
5.000NO
40hsa-miR-148a67796801-12.7121
uguuUCAAGA-CAUCACGUGACu
|| ||| || |||::||
gatgAGGTCTCGTTCTGCGTTGg
NONO
41hsa-miR-148b67796801-12.2121
uguuUCAAGA-CACUACGUGACu
|| ||| || |||::||
gatgAGGTCTCGTTCTGCGTTGg
NONO
42hsa-miR-148b28082828-14.8121
uguuUCAAGAC-ACUACGUGACU
|| |||| || |:|||||
gagcAGCTCTGTTG--GTACTGA
NONO
43hsa-miR-149486507-20121
ccUCACUUCUG-UGCCUCGgucu
|| |||||| ||||||
caAG-GAAGACTTCGGAGCggtc
5.000NO
44hsa-miR-14937753796-22.9121
CCUCACUUCUGUGCCUCGGUcu
|| ||||||:|||:| ||
GGCTCGAAGACGCGGGGACAag
5.000NO
45hsa-miR-14951265146-12.3121
ccUCACUUCUGUGCCUCGGUcu
|||| : :| : |:||||
acAGTGTGCGC-TAGGGCCAaa
5.000NO
46hsa-miR-15058455862-13.4121
GUGACCAUGUUCCCAACCCUCu
|| ||| | || ||||:|
CAGTGG--CCTGG--TGGGGGc
7.336NO
47hsa-miR-15176087633-15.9121
gGAGUU----CCUCGAAGUCAGAUca
||||: ||:|: |::|||||
gCTCAGGCTCGGGGTCTTGGTCTAct
NONO
48hsa-miR-1642524269-16121
GCGGUUAUAAAUGCACGACGau
||||:| |: | |||||
CGCCGA----TGGGGGCTGCgc
11.196NO
49hsa-miR-17-5p51155140-17.5121
uGAUGGAC--GUGACAUUCGUGAaac
||||| | :|| ||: ||:||
cCTACCAGGCTACAGTGTGCGCTagg
8.771NO
50hsa-miR-181b60836102-15121
ggGUGGCUGUCGUUACUUACaa
|:|:| | |||||:|||
ggCGCTGTC--CAATGGATGaa
6.484NO
let-7a
Target on hcv 2a 
Binding site 5651-5678
mfe : -12.3
Hybrid sequence
UUGA--UA--UGUUGGA--UGAUGGAGu
AACTTCATCAGCGGCATTCAATACCTCg let-7a
Target on hcv 2a 
Binding site 2702-2723
mfe : -13.4
Hybrid sequence
uuGAUAUGUUGGAUGAUGGAGU
ccCTTGGCTACTTATTCCCTCA let-7b
Target on hcv 2a 
Binding site 6228-6260
mfe : -16.32
Hybrid sequence
uUGGUGUGUUG-------GA----UGAUGGAGU
gACTCCACAACTGGATTACTGAAGACTGCCCCA let-7b
Target on hcv 2a 
Binding site 8750-8770
mfe : -14.8
Hybrid sequence
uuggugUGUUGGAUGAUGGAGU
ctgataACATCTTGCT-CCTCA miR-100
Target on hcv 2a 
Binding site 3229-3250
mfe : -13.9
Hybrid sequence
guguucaagcCUAGAUGCCCaa
ggctgctaatGGCCTGCGGGac miR-100
Target on hcv 2a 
Binding site 5910-5927
mfe : -12.9
Hybrid sequence
GUGUUCAAGCCUAGAUGCCCaa
CA-GGGTATGG---TGCGGGca miR-100
Target on hcv 2a 
Binding site 6912-6931
mfe : -16.9
Hybrid sequence
GUGUU-CAAGCCUAGAUGCCCaa
CGCGGCGTTTGGC---ACGGGgg miR-101
Target on hcv 2a 
Binding site 1037-1058
mfe : -12.3
Hybrid sequence
gaagucaaUAGUGUCAUGACau
gggaatacATCTCGGTGCTGga miR-103
Target on hcv 2a 
Binding site 1332-1358
mfe : -17.9
Hybrid sequence
aGUAUCGGGA---CAU--GUUACGACGa
cCATGATCCTGGCGTACGCGATGC-GCg miR-103
Target on hcv 2a 
Binding site 7260-7283
mfe : -17.7
Hybrid sequence
aguauCGG-GACAUGUUACGACGa
aaccgGCCACTGTTGCGGGCTGCg miR-105
Target on hcv 2a 
Binding site 4827-4849
mfe : -17.5
Hybrid sequence
uGUCC---UCAGACUCGUAAAcu
gCAGGGGAAGACTGGGTATTTat miR-106a
Target on hcv 2a 
Binding site 5115-5140
mfe : -15.72
Hybrid sequence
cGAUGGAC--GUGACAUUCGUGAaaa
cCTACCAGGCTACAGTGTGCGCTagg miR-107
Target on hcv 2a 
Binding site 3639-3667
mfe : -12.8
Hybrid sequence
aCUAUCGGG---ACAU---GUUACGACga
cGGTCACACAGATGTACTCCAGTGCTGag miR-107
Target on hcv 2a 
Binding site 5845-5866
mfe : -18.1
Hybrid sequence
acuAUCGGGACAUGUUACGACGa
cagTGGCCTGGTG-GGGGCTGCc miR-107
Target on hcv 2a 
Binding site 7260-7283
mfe : -17.7
Hybrid sequence
acuauCGG-GACAUGUUACGACGa
aaccgGCCACTGTTGCGGGCTGCg miR-10b
Target on hcv 2a 
Binding site 4823-4844
mfe : -15.4
Hybrid sequence
UGUUUAAGCCAAGAUGUCCCAU
ACGGGCAGGGGAAGACTGGGTA miR-124a
Target on hcv 2a 
Binding site 3252-3274
mfe : -25.32
Hybrid sequence
ACCGUAAGUGGCG-CACGGAauu
TGGCGGTCGCCGTGGAGCCTatc miR-124a
Target on hcv 2a 
Binding site 8544-8567
mfe : -13.5
Hybrid sequence
accGUAAGUGGCGC--ACGGAAUu
tcaCATGCTATGTGAAAGCCTTAg miR-125a
Target on hcv 2a 
Binding site 6912-6931
mfe : -15.8
Hybrid sequence
GUGUC-CAAUUUCCCAGAGUCCCu
CGCGGCGTT---TGG-CACGGGGg miR-126
Target on hcv 2a 
Binding site 4918-4938
mfe : -16.1
Hybrid sequence
cguaauaauGAGUGCCAUGCU
tgcaggggcCGCATGGTATGA miR-127
Target on hcv 2a 
Binding site 4904-4929
mfe : -12.1
Hybrid sequence
uCGGUU-CGAGUCU--G-CCUAGGCu
tGCGAGTGCTACGATGCAGGGGCCGc miR-128a
Target on hcv 2a 
Binding site 3866-3884
mfe : -15.8
Hybrid sequence
uuuUCUCUGGCCAAGUGACAcu
cccAGAGGCC---ACGCTGTcg miR-128b
Target on hcv 2a 
Binding site 2318-2341
mfe : -13
Hybrid sequence
CUUUCUCUGGC--CAAGUGACAcu
GACAGAGACAGAAGTCAACTGTct miR-128b
Target on hcv 2a 
Binding site 3866-3884
mfe : -15.8
Hybrid sequence
cuuUCUCUGGCCAAGUGACAcu
cccAGAGGCC---ACGCTGTcg miR-132
Target on hcv 2a 
Binding site 937-963
mfe : -14.32
Hybrid sequence
GCUG--GUACCGAC---AU-CUGACaau
CGGCTACATGG-TGACCAACGACTGcac miR-133a
Target on hcv 2a 
Binding site 7516-7538
mfe : -17.4
Hybrid sequence
ugucgaccAACUUCCCCU-GGuu
gccccctcTCGAGGGGGAGCCtg miR-133a
Target on hcv 2a 
Binding site 508-529
mfe : -14.5
Hybrid sequence
uGUCGACCAACUUCCCCUGGUu
cCAGCCACGTGGAAGGCGCCAg miR-133a
Target on hcv 2a 
Binding site 1377-1396
mfe : -12.1
Hybrid sequence
UGUCGACCAACUUCCCCUGGUu
ACATC--ATTGGCGGGGCTCAt miR-133a
Target on hcv 2a 
Binding site 7225-7253
mfe : -13.5
Hybrid sequence
UGUCGACCA-------ACUUCCCCUGGUu
ACCGCTTGTGGAATCGTGGAAGAGGCCAg miR-133a
Target on hcv 2a 
Binding site 7963-7983
mfe : -13.6
Hybrid sequence
ugUCG-ACCAACUUCCCCUGGUU
caAGTATGG--GTTTGGGGCTAA miR-133b
Target on hcv 2a 
Binding site 8216-8235
mfe : -18.3
Hybrid sequence
aUCGACCAACUUCCCCUGguu
cAGGCGG-TGATGGGGGCttc miR-133b
Target on hcv 2a 
Binding site 2289-2305
mfe : -13.3
Hybrid sequence
aucGACCAACUUCCCCUGGuu
tcaCTCGT----GGGGATCgt miR-133b
Target on hcv 2a 
Binding site 7517-7538
mfe : -15.7
Hybrid sequence
aucgaccAACUUCCCCU-GGuu
ccccctcTCGAGGGGGAGCCtg miR-133b
Target on hcv 2a 
Binding site 7964-7983
mfe : -13.7
Hybrid sequence
aUCG-ACCAACUUCCCCUGGUU
aAGTATGG--GTTTGGGGCTAA miR-134
Target on hcv 2a 
Binding site 4326-4351
mfe : -13.3
Hybrid sequence
GG-GAGACCAGUUG----GUCAGugu
CCATTCTCGGCATCGGAACAGTCctc miR-134
Target on hcv 2a 
Binding site 5237-5260
mfe : -16
Hybrid sequence
ggGAGACCA--GUUG-GUCAGUGu
ggCTCTGTTACCAACGAGGTCACc miR-134
Target on hcv 2a 
Binding site 9032-9052
mfe : -16.2
Hybrid sequence
GGGAGACCAGUUGGUCAGUGU
CCCTTGGACCTCCCAGCCATA miR-143
Target on hcv 2a 
Binding site 5633-5662
mfe : -13.4
Hybrid sequence
ACUCG----AUGU-CAC---GAAGUAGagu
TGGGCCAAACACATGTGGAACTTCATCagc miR-147
Target on hcv 2a 
Binding site 5658-5681
mfe : -12.6
Hybrid sequence
cGUCUUCGUAA---A-GGUGUGUg
tCAGCGGCATTCAATACCTCGCAg miR-148a
Target on hcv 2a 
Binding site 6779-6801
mfe : -12.7
Hybrid sequence
uguuUCAAGA-CAUCACGUGACu
gatgAGGTCTCGTTCTGCGTTGg miR-148b
Target on hcv 2a 
Binding site 6779-6801
mfe : -12.2
Hybrid sequence
uguuUCAAGA-CACUACGUGACu
gatgAGGTCTCGTTCTGCGTTGg miR-148b
Target on hcv 2a 
Binding site 2808-2828
mfe : -14.8
Hybrid sequence
uguuUCAAGAC-ACUACGUGACU
gagcAGCTCTGTTG--GTACTGA miR-149
Target on hcv 2a 
Binding site 486-507
mfe : -20
Hybrid sequence
ccUCACUUCUG-UGCCUCGgucu
caAG-GAAGACTTCGGAGCggtc miR-149
Target on hcv 2a 
Binding site 3775-3796
mfe : -22.9
Hybrid sequence
CCUCACUUCUGUGCCUCGGUcu
GGCTCGAAGACGCGGGGACAag miR-149
Target on hcv 2a 
Binding site 5126-5146
mfe : -12.3
Hybrid sequence
ccUCACUUCUGUGCCUCGGUcu
acAGTGTGCGC-TAGGGCCAaa miR-150
Target on hcv 2a 
Binding site 5845-5862
mfe : -13.4
Hybrid sequence
GUGACCAUGUUCCCAACCCUCu
CAGTGG--CCTGG--TGGGGGc miR-151
Target on hcv 2a 
Binding site 7608-7633
mfe : -15.9
Hybrid sequence
gGAGUU----CCUCGAAGUCAGAUca
gCTCAGGCTCGGGGTCTTGGTCTAct miR-16
Target on hcv 2a 
Binding site 4252-4269
mfe : -16
Hybrid sequence
GCGGUUAUAAAUGCACGACGau
CGCCGA----TGGGGGCTGCgc miR-17-5p
Target on hcv 2a 
Binding site 5115-5140
mfe : -17.5
Hybrid sequence
uGAUGGAC--GUGACAUUCGUGAaac
cCTACCAGGCTACAGTGTGCGCTagg miR-181b
Target on hcv 2a 
Binding site 6083-6102
mfe : -15
Hybrid sequence
ggGUGGCUGUCGUUACUUACaa
ggCGCTGTC--CAATGGATGaa