>U27813|Murine polyomavirus strain LID, complete genome.
gaattcaaatgcctggtccattatgaggaggggggcatgctgttctttctaactatgact
aagcacagggtttcagcagttaagaattattgctctaagctttgcagcgtcagcttccta
atgtgtaaggcagtcaccaagcctatggaatgctatcaagttgtaaccgcagcaccattt
cagttaataacagaaaataagccaggcctccaccaattcgagtttacagacgagccagaa
gaacagaaagcagtagactggattatggtagcagactttgcactagaaaacaaccttgat
gatcccctgttaattatggggtattatcttgattttgccaaagaggttccttcatgcata
aagtgtagcaaagaggaaacccgcctccaaatacattggaaaaaccatagaaagcatgca
gagaatgcagacctcttcctgaattgtaaagctcaaaagacaatctgtcagcaggcagct
gacggagtcttggcatccaggagactgaaattagtagagtgtacccgcagccagctatta
aaggagagattgcaacagtctctcctcaggctaaaagaacttggctcctccgatgctcta
ctctacctagcaggtgtcgcttggtaccagtgtcttttagaggactttcctcaaaccctg
tttaagatgcttaagctgctaacagaaaatgtgccaaaacgacgcaacatactttttaga
ggaccagttaattcaggaaagacaggcctagcagccgcgcttattagcctgttaggaggc
aagtctctcaacataaattgccctgcagataaacttgcttttgagcttggtgtggcacag
gaccagtttgtggtctgttttgaagatgtaaagggtcaaatagccttgaacaaacaactg
cagccagggatgggagtggctaatctagataatctcagggactacctggatgggagtgta
aaggtcaatctagaaaaaaagcacagcaacaaaaggtcacaactctttccaccctgtgtg
tgtacaatgaatgaatatctcctaccacaaacagtatgggcccggtttcacatggtgttg
gatttcacctgcaaaccccatctggcccaatctcttgaaaagtgtgaatttttgcaaagg
gaaagaattattcagagtggagatacccttgccctattactcatatggaatttcacttca
gatgtatttgatcctgatattcagggtcttgtgaaggaggttcgtgaccagtttgctagt
gagtgctcctacagtttgttttgtgatatactttgtaatgtgcaagaaggcgacgacccc
ttgaaggacatatgtgaatatagctgaatacacagtttattgaataaacattaatttcca
ggaaatacagtctttgtttttccaaagcggtcaacatagcgcgtcatatcagggtccccc
ggtacaggttcagtcccatcatacactctaacctcctctacctgggtgttctccccttcc
atgggttggccctgcacttgggggagcatgttgttgaaaagggaacttatgagggaggcc
atgggatagggatttttgacccatctttttctcagggtgattttgaaatatctgggaagc
cctctccagtgatgggcatcatagtttcttgtaactctccagcccattatatctacacag
gagaggtataggccctctcctttacagaggggcccaactccattttcatctaggagcaca
gttgtcagggtgtttgtgaactgcaggacgggtggagttgttgtgcctccagtgtaattg
ccaaagtaccttgtgttctcattttttgctggatctggatgccagatttcaactggatac
attccgtccttatccagcttggccttgctaattggattcaggacttggtctttgttgacc
atatccttctttgtgattgttttgattgttactaccccttcttccttgaattttgttctg
gcatctgtcacaagtccctggaggtcaagcggttccccgcccacagcaaacacatgatat
tggctgccttccactggagtggaaattccttttgtgtttactgtatctgtgggtttgttg
aacccatgcacatctaacagtgagccagagcccaccacctcggttttcactgagactgcc
tcccacatttgtagggtgtcacaggtgaggtcctcattgagcatgggaagctggagcttt
gccatactccatgtgggaagtgtattattttctggggaatcctctgtatctgatgtagcc
aaattaatccctctgctccaaccatagtattgccctccctctgttaggctttcaggggtg
ggtggctgccccattctggggttcagaaaagcttctatttctgtcacactgtctggccct
gtcacaaggtccagcacctccataccccctttaataagcagtttgggaacgggtgcgggt
cttggacaggcctttgtacattttgtctcgcatttagagacgccgctttttcttttgggg
gccatcttcctctatgactgttgcccaagtaggtgtgatatcaccgtacagccctagaat
taaaggaagcatccagtcaggagtgactctttggtgggcaccacctggggcctgatagaa
ctttatcacctcacctgactcatcctgtatatgtgctgcaggggtaggcccaccatttcc
catgctcccttctatgcgattaaagagtgctctcctctgtggtggattaagacctagttg
cctataatagtcacttagtgatgagtaccctgagctcactgatgaggcacctctgttgat
tgcatctatggctgactgaggagcattagaaaccacccaccgggtgttttcaagtagcct
agctaggccatccaggaatgtatgtgtctgtcttacagttagttctcttacagctccttc
cagtctgtgttgtgtttcctgcacaaccatttgccacacatatcttcccacggaatgaag
taggccatggccccaatcatgtactacatttagagcatgagcaaactgattaactcctgg
gaagtatatatcgagaagggctggatcccgccatggtatcaacgccatatttctatttac
agtagggacctcttcgttgtgtaggtaccgctgtattcctagggaaatagtagaggcacc
ttgaactgtctgcatcagccatatagcccccgctgttcgatttacaaacacaggcacagt
actgacaaacccatacacctcctctgaaatacccatagttgctagggctgtctccgaact
cattacaccctccaaagtcagagctgtaatttcgccatcaagggcagcgagggcttctcc
agataaaatagcttctgccgagagtcccgtaagggtagacacttcagctaatccctcgat
gaggtctactagaatagtcagtgcggctcccattttgaaaattcacttacttgatcagct
tcagaagatggcggagggcctccaacacagtaattttcctcccgactcttaaaatagaaa
atgtcaagtcagttaagcaggaagtcactagctgaccgcagctgagtcactagctgaccg
cagctggccgtgcgacatcctcttttaattagttgctaggcaactgccctccagagggca
gtgtggttttgcaagaggaagcaaagaatgtttccacccactcattactatgacaacagc
tgttttttttagtattaagcagaggccgggggcccctggcctccgcttactctggagaaa
aagaagagaggcattgtagaggcttccagaggcaacttgtcaaaacaggactggcgcctt
ggaggcgctgtggggccacccaaattgatataattaagccccaaccgcctcttcccgcct
catttcagcctcaccaccatcatggatagagttctgagcagagctgacaaagaaaggctg
ctagaacttctaaaacttcccagacaactatggggggattttggaagaatgcagcaggca
tataagcagcagtcactgctactgcacccagacaaaggtggaagccatgccttaatgcag
gaattgaacagtctctggggaacatttaaaactgaagtatacaatctgagaatgaatcta
ggaggaaccggcttccaggtaagaaggctacatgcggatgggtggaatctaagtaccaaa
gacacctttggtgatagatactaccagcggttctgcagaatgcctcttacctgcctagta
aatgttaaatacagctcatgtagttgtatattatgcctgcttagaaagcaacatagagag
ctcaaagacaaatgtgatgccaggtgcctagtacttggagaatgtttttgtcttgaatgt
tacatgcaatggtttggaacaccaacccgagatgtgctgaacctgtatgcagacttcatt
gcaagcatgcctatagactggctggacctggatgtgcacagcgtgtataatccaagtaag
tatcaagagggcgggtgggtatttacggcctatattcttacagggctctccccctagaac
ggcggagcgaggaactgaggagagcggccacagtccactacacgatgactactggtcatt
cagctatggaagcaagtacttcacaagggaatggaatgatttcttcagaaagtgggaccc
cagctaccagtcgccgcctaagactgccgagtcttctgagcaacccgacctattctgtta
tgaggagccactcctatcccccaacccgagttctccaacagatacacccgcacatactgc
tggaagaagacgaaatccttgtgttgctgagcccgatgacagcatatccccggacccccc
cagaactcctgtatccagaaagcgaccaagaccagctggagccactggaggaggaggagg
aggagtacatgccaatggaggatctgtatttggacatcctaccggaggaacaagtacccc
agctcatccccccccctatcattcccagggcgggtctgagtccatgggagggtctgattc
ttcgggatttgcagagggctcatttcgatccgatcctagatgcgagtcagagaatgagag
ctactcacagagctgctctcagagctcattcaatgcaacgccacctaagaaggctaggga
ggaccctgctcctagtgactttcctagcagccttactgggtatttgtctcatgctattta
ttctaataaaacgttcccggcatttctagtatactccaccaaagagaaatgcaaacaatt
atatgataccatagggaagttcaggccc