>NC_007573|Rotavirus C segment 11, complete sequence.
GGCTTTAAATTTTTCAGATCACTTTGCTCTACGAAGTAATGGATTTCATCAATCAAACTT
TGTTCTCAAAGTATACTGAAAGTAATGTAGATACAATTCCTTATCTTTTGGGTCTTATTC
TTGCATTAACTAATGGATCAAGAATACTTAGATTCATTAACTCATTCATAATCATATGTA
AGCACATAGTGACTACGTCTAAATCAGCTATTGACAAAATGAGAAAAATTAATAATTCGG
AACATAACACAAAGAATGCGCATGAAGAATATGAAGAGGTAATGAAGCAGATAAGAGAAA
TGCGTATTCATATGACTGCATTGTTTAATAGTTTACATGATGATAATGTTAAATGGAGAA
TGAGTGAATCTATTCGCAGAGAAAAGAAACATGAAATGAAGATGAGTGATAATAGAAATG
AATTCAAACATTCACATAATGATACAAATATATGTGAAAAATCTGGATTAGAGACGGAAG
TTTGTCTATGAAATCCCTGCGCTTCCTGCTGGTGAACGGACGCCATCCCGTTCATTTCTA
GCGAGTAGAGAAAAACATTGTACCCGAAACGCTGAGTTGAGGATCAATGTAGATATGAAA
AATTCATGTGGCT