>NC_007018|Human parvovirus 4, complete genome.
ACGAGGCCTCGTCGCATATGTATTACATCAAAAATTAGCCACGCCCTTCCGGTTCCGGCC
ACGCCCTTCCGGTTCCGGTGACGTGCTTCCGGCCACGTCAACTTCCGGCCACGTCAACTT
CCGGTGACGTATTTCCGCTTCCGGTCCCGCGAAAATTACGTATTTCCGCTTCCGGGACAC
GTCCGCTTAAAAGCGGAAGTGACGCCCTTTCCCAACCACACCTACCTCGCCTATAAGAAT
CAGTGTCAGTTCCTCTGACTCACTCTGTTCGTAGAGGTCACCATGGACGCTCCTGCCTGG
ATTGCCGTGCTACAAATTCCTACTGGATTTCTCTCCAACCCAGCAAACTGGAGGGATTGG
GATGGCCTGCAAAGACCCCGCAATCTTCTCGCCGACGACTGGCCTATACAGGAGCTCCGT
GAGTCTGTTCCATTTTTTGACCATGCTGTTAATTTAGGCTACTGCATATTACAACAGCTG
TTTGCCTCGCATGCTGTTACTCTGCCATGCAGAGTGAAGCCTAGCATGTTTTTGCAGTTA
GAACCAAGTAGTGGAGAAGAGAATGAAATGCACTACCATTTAGTTGTGAACCAAGCAGAC
ATGGTAGGCAGAGAATGTAGCAACTGGCTGCGCACCTGGAAAGTCTTTATGGCTGGATAT
TTGGTAGCTCCTGTGTGGACTTTAAGTTGGAACATTAGAGAAACCCGTCAAGGGCGACTA
TATCAGGCTGATATGAGTTTTGTGAAAAATTACCTGCTACCTAAGCTACCACTGAATGAT
TGCTATTATGCATGGACTAATATAGACAGGTTTGAAGCAGCTGTACTGAGCGTGCGCAAC
AGACAGCTTTCAGGTCCTCAAGGTGCTATTGCCTTACCATTCACTGACGCACCTCCACGG
ACACCAGCTGCAGAAGGAGTTCCTCCAACTATGGCAGGAAAAGGAACACAAAGATTCATG
GATCTTATTGACTGGTTAGTTGAAAATGGAATAGCCACAGAAAAGAGGTGGTTATCAGTG
AATAAACTCAGCTACAGGTCCTTTCTAGGAAGCAGTGGTGGAGTTCTTCAAGCAACAAAT
GCACTACAAATAGCTAAAAGAGAAATGGTTTTAGCCCACCCTTTATTAAGCTACCTGACA
AAGAATGCTTCTGCTTTTGAAGAAAGTAATAAAGTTGCACAGCTGTTTAGCTTAAATGGC
TACAATCCTGTTGACGCTGCATGGTATTTTGCAGCATGGGCAAGAGGAGTGTGGCCCAAA
AGAAGAGCCATATGGCTCTGGGGCCCAGCTAGTACAGGTAAAACTCTGTTAGCTGCTGCC
ATAGCAAATCTTAGTCCATCTTACGGTTGTGTGAATTGGACAAACCAAAATTTCCCATTT
AATGACTGTCACTGTCAAAGCTTAGTGTGGTGGGAAGAAGGCAGAATGACAGAGAACATT
GTTGAAGTAGCCAAAGCTGTGCTTGGTGGAGCACCTGTGAGGTTGGATGTAAAGAACAAA
GGCAGCGAAGACTACATACCTACCTGTGTCATCATTACCTCTAATGGAGATTTAACAGTT
ACAGTTGATGGCCCTGTGGTTAGCACCCAGCATCAAGAAGCTTTGCAGACAAGAATAACC
ATGTTTCAGTTTCAGAGAATGGTTCCGGATGGCTTAGCTCCACTTCCTGAAGAGGAAGTG
AGAAGCTTTTTTAAGCTAGGTGAACAGGAACTGAATATGAAAGGCACACCTCCAGAAGAA
TTTAGAGTGCCAAGAAACTTTGACAAACAACCAATGGCATCTACCAGCAACTTGCCAAAA
GCCTTGTGTGCACCAATGGAAGACAACCAAGTACAATGGGATTCTGAAGATGATTGGTTT
CCACCACCCACTCAGAAGAAAAGGCGGGAACTTCAAGAGACACCTCCAACCACTCCCAGT
GAAGTCATTGAGCTGTCCTCTCCGAGTCCATTAGCAGACGCGCCGCCGAGGACACCAGAC
AGTCTGGGAGAATTGTCTCTAACTCCTACTTCTGTAAGCCAGATTGTTTCTGCACCATTT
CCTGACGAAACTGCTGAAAGGTATGGAGCTGGGGACATTGAGTCTTTCTGGTCTGAACAT
GTGTTTGATGCAGATTGGGCTACAAGGCTACACATTTGTCCCCCAGGTGGTCCTAAACCT
TACGGACTTTTTTGGACTTACTTATGGTCTCGAGAGTTTTGGAGGTTTAAGCAGAGTCTG
AGCCGTTCAGAGGCTCATTTGATAAATAGAAGATTTATTTGGGCTTGGTGGTAAGTGTGA
TTTTATGTTTTCTTTGATTTTCTTGTAGACTTGTTCCTGACGCTGCTACAGGAGCAGAAG
ACTAACAAGCTTCATTTATTTTTCCAGGTAAGCAAACATGTCTGCTGCTGATGCTTATCG
TCCAGGTGGCAAGCTGCCTCTAGATGAGCTAATGCAAAGAATGAATAGAGCAATTCCTGT
GGGACCGGAACCTTCAAGTCAAGCCAACCGCGGAGGGGGGCCATATCAAACTCACTTTGC
TATAGGAATAATGTACTCCAAGGCTTTCCAAGGCTTGCTTAGATTTGCTAATGCTTTACC
TCCTGAATTGAGCCCTGTAAAACAGCTTGTTAATCAGTTAGAAAATTATAGGCGTAAGAC
ATCTGATACCAGGGTATGGTACAGAGTGTACTTAGACATGACAAGACTTCTAATTTCTGT
GGCTCCTCCAGGAGCAGCAAACAAACTCAGACAGGCAGCAGCAGGTATAACTCACTCAAA
AGCCCCCAATGCTGAAAGCCTGAGAGGCATTGTGCGGTTCGCAGCTGCTGCTTTTGTACC
TACTGTAGAAAATATTGATAGATTTTTTGAAGACTCGCTAACGAACTTTGCCAAAGAAGA
CTTAGACACCTGGCAACAACTCCACGAGCAGTTTATCAAACTCTTTCACCCTCCAGATGT
CGGAGTCCACCTTGTTAGTGACAGCCGCGATGAAGGAGCTGATTCCCTTGTTGAACCAGA
CCTTGAGCGGCCTGCCGGAGGCGGGCTTACTCTCCCCGGGTATAATTATGTTGGTCCTGG
TAATCCTCTGGATAGTGGTCCCCCTCAGGGACCAGTGGATGAGGCAGCAAAACATCATGA
TGAACGGTACGCAGAGATGATTGAGCATGGGGACATCCCTTATTTACATGGTCACGGCGC
TGACAGATTAATGAACAAAGAGTTAGAAGAAAAAGAGCGCCGGGGGGACATTACACACTT
AGCAGATGTAGTAGTTGGCAATGCTATTAGAGGTTTATGGCAGGCTAAGGAAACTGTTGG
TGATATTGCTGATGTTCAACTTTCTCAGGTCCTACCGCCCGCTCCTCCTTCTTCGGACCA
ACAACCGGCTTATTCCGCAGGAGAGCCCTCAGCCAAGAAGGCGCGGATTGGTACCCCTGA
CGAGTCTGACCCGGCCTTGCTTCTGCAGCCTCATACCAATACAATGTCCGTGGAACCAGC
TGGAGGAGGAGGTGGAGTTAAAGTTAAAGCTCAGTGGATAGGTGGAACTAGTTTTTCTGA
TTCTGTAGTTATTACTTCACATACTAGAACTTCAATGTTAGCTGATAGAGGGGGGTATGT
GCCTGTGTATAAGCAAGGAAGTCATGTAGATTCTTCGCAGCCTGTAATGGGTATGAAAAC
ACCTTATTCTTACATTGATGTTAATGCTTTATCTGCTCATTTTACTCCTAGAGACTTTCA
GCAACTGCTAGATGAATATGATGAAATTAAACCTAAAAGCTTAACTATTGCAATTTCTGC
TATTGTAATTAAGGATGTTGCAACCAATCAAACAGGTACTACTGTTTCTGATTCTGCAAG
TGGTGGGATTACTGTATTTGCTGATGATAGCTATGACTATCCATATGTATTAGGTCATAA
TCAAGATACATTACCAGGTCATTTACCAGGAGAAAATTATGTATTGCCTCAGTATGGGTA
CATTACAAGAGGCAGAGAAATTGATCAACAGAACAGCATTGTAGCTATTAGTGATCATAA
GACAGAACTGTTTTTTTTAGAGCACCATGATGCAGAGTGTTTGGGTACAGGAGATCACTG
GTCTCATCACTATGAGTTTCCAGATGACCTACCTTGGAGAAAATTGTCAACTCCCAACCA
AACATTGTATGCAAGACATAATCCAATTCCTTCTAGCAGGTTAGCTATTATGACAGGTGT
TGATAATGATGGGACTGCCATTTGGAAACGCCCTGAAGGCATGGATGTTGGCAGACTCCC
ATTAAATTATGTTCCAGGGCCAGCTCTAATGATGCCAACAGACACCCAAATTAGAAACAC
AACTTTCAGAGATCCTGTGGCTATTGGAAATCCTGCTACAAGTGACAGGTATAGTGTAGC
TCCTTTAGTCCATCAACCATGGTCTGTCCGTACAGAAGAATGGCTAGCAAACAAAACAGA
CTATGCTGTTCATAATTATTTAGGAGGTGTTGCATACACTAGAAGAAAGCATGAAGAGTC
TTATGATAAACATGAGGAGGACCGAGATGGTAGAGTTACTAACCCATCCAGAGTTGTTCA
GATAGATGGTGATTTAGCAGCTCCTCATGTGGGTCACACGTTTTTTGTTCCTGGACACAC
CAGAGTTACCTCTGGTGGTACTGATACAGTGTACAGCCCAAAATTATATCAGGAACCTGT
GTTTCCTTTGTTTCCTGGTGCTGTTTGGAACCCAAATCCTTTATCATATGATTGCCAAAT
ATGGACTAAAATTCCTAATACAGAATGTCATTTTTTTGCTCAATATCCTCTTTTGGGAGG
TTGGGGAGTTCTTACTCCTCCTCCAATGATTTTTGTGAAGCTCAGGTCACAACCAGGCCC
TCCTAGTCCAGGTGCTCACACAGTTCCACAATCTAATTTAAACCAGTATGCAATTTTTCA
CTTGCATTATAGTATGCAGTTTTTAGTTAAGCGCCGCAAGAGATCTCGCCGCCATAATCC
CGAGAAACCTGCTCCTTTCCCGACAACAGATTCGGGACGTATGCCTTTTACCCTTGCCAA
TAGCTTAAAAGACCCCAATACACCAGTGTATGAAGTGCCTTCTGATCAATGGATTGCGCG
AAATTATTCTCATTTGCTGTAATAAATTTATAAAATTTCATTGCTGTGAGACTGATTCTT
ATAGGCGAGGTAGGTGTGGTTGGGAAAGGGCGTCACTTCCGCTTTTAAGCGGACGTGTCC
CGGAAGCGGAAATACGCAATTTTCGCGGGACCGGAAGCGGAAATACGC