>NC_006966|Mule deer poxvirus, complete genome.
AACATCTATTATTTTTTATTAATTTTATAATTTATATACCTAAAAAAAAGATAAAAACAA
TAGAATAAAACTACCCGAATGATGGGTTTATTCCTTTATGAAGGTATGGGAAAGGGATAA
AATGTTTTATTCCTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCC
TTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCCTTTATTCAGGTAT
GGGAAAGGGATAAAATGTTTTATTCCTTTATGAAGGTATGGGAAAGGGATAAAATGTTTT
ATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCAGGTATGGG
AAAGGGATAAAATGTTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATT
CCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCAGGTATGGGAAA
GGGATAAAATGTTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCT
TTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCAGGTATGGGAAAGGG
ATAAAATGTTTTATTCCTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTA
TTCCTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCCT
TTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCCTTTATTCAGGTATG
GGAAAGGGATAAAATGTTTTATTCCTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAA
ATGTTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCCT
TTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCAGGTATGGGAAAGGG
ATAAAATGTTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTA
TTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCAGGTATGGGAAAGGGATA
AAATGTTTTATTCCTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTC
CTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCCTTTA
TTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCCTTTATTCAGGTATGGGA
AAGGGATAAAATGTTTTATTCCTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATG
TTTTATTCCTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTA
TTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCCTTTATTCAGGTATGGGA
AAGGGATAAAATGTTTTATTCCTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATG
TTTTATTCCTTTATTCCTTTATTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTA
TTCAGGTATGGGAAAGGGATAAAATGTTTTATTCCTTTATTCCTTTATTCAGGTATGGGA
AAGGGATAAAATGTTTTATTCCTTTATGAAGGTATGGGAAAGATAATTTATACATCAAAT
AAAAACATTTAGTATAACAACTTTATAAAATTTATATTTTGAGCATTCTATTAATCAATA
TTGCCTTTACAGATGTCAAATCTTCGAATGTTAATAATTCACCCAATAACATTAGAACCT
TAGCAGAGGCGCGTGTGGGAATAGATTCACCACCCCAATATTCTGCGGCTTTTGCTAATA
GACCGACGATTGCACAGGCTTCTTGTGTAAGGTTTTCCCTTTCCAAGGAAAGACCAATAA
AAGATTTTGCATGATTAAATCCCTCTTTTGAATCCAAGAATAATAATTTTACAAATGTTG
TCAAATCTTTACCAAATACTTCTATAGCTTCCTGTTTAAATGATTCAAGAGCAACGAACA
CATTTCCGGCTCTATCTCTACTACGAAATTCTTTGGATGACCAATATAAATAATCGGCAA
TGGCCACCGTTATATCGTCGGATTCAGTAAATTCATCACAATATGCATAGTTAACAATAT
GGTATTGATGTTCCATATTTGTTTATTGTAAAAGAAATATAACAGCGGAAGGCTGTTATA
AACGTATATGTCTCGAATTTATTTTTCATCTTATATTATTTATTCAACCATTTCAACCAT
CTTCTCTAAAAAACTTTTCTCAATTTTTTCTTCAACCTTTTTCGGTTGAGTTTTTGCTTT
TTTATAGGGATAAGGGTAACAATATTCGTAGTATCGTTTGAATGGATTAGGCATTTTCAT
AAAATCAAATACGCCATTAAATCTATCCTCTTCGGGCTTTATAGCCTTTTCCACAACGCC
AGCGCCATTGTTGGATTCCGATATTGGGGGTTTTTCCGCTTGTTCCTTAAGTTTGGGTTT
TATATTGGGGGTGGGATTCGGTTCCGGAGGCATGATGGGTAAATATATTTTTTCATCATC
GGGAAAGATTTCCGCATCGTCATCTTTTTTATGTGGATCCGGAAGTACATCATGAAACGG
ATTTAGTTCTCCAAACATAAAAGAAATTAATTTTTTCATAGGATACATCGATAGAGAATA
CAGACTGTATATAATTAGATTGCATAATCTAGATAAATAAAATATGCATAGCATGCAGAT
TTTTGCAAAGCTATTTATCAATAATTGACAAAATCCTTTCAATGCATATGCGATGAATCC
TATAACCTTAAGAATTAATACTATCGTCCCTCTCACACACTTCCATATCCCAAAAATAAT
TTTGTGAACGAGGGAGGAAATCCACCAAACTAAAAAAAAATAGAAAACTCAGGTTTCTCC
GCCATAATTTATTAGACATGAAATATAATAATTATTGGGGAATGGATATTCTACCTATAA
AGAGAATTTCATTTTCATATTCTATTATAAAGATGAAGGGACGGTTCACGTATATGGATT
CAATGCGAAAGAGATGTTGGTATGTATCTTCTTGAGTATTATATCTCATTTTCTTTGTTA
TATTTTTTGTATTTGTTCCTTCTTCATCTATCTCAAGAATAATTTTTTGATATACGGATG
GGGGAAGAGGATATAGATCATCCTCTTTATCCCCTTGTGTAATCATACGCGAAAGATTGG
GATTTGTGAACAATGTTTTAATCCCTGCAGAAGGCAGTAAATGTTCCGCGTTAAAAGAAT
GTTCTATTCTAAACTTAGGAATGGAGAGCTCTAGATACTTTTTTCTCGATGCGTATTTAA
ATGCCTTTAGCGTATCGCCATGCATCATGTTTTCTAGTTGATTCAATTGGTCGTTAGATA
TAGCGTCTGGAAATACGATCCACATATGCGACCGTGAACAATTGCCATAAGGAATTTCAA
TGATATTAGACTGATGATATCTACCCACATTAAATATACCTTTCGTCGTCATCATATTTA
CGTATTTAAAGGAAACCTTATCTATATTGAAGATATCCATCGTAGTTTTTTTACGTAAAA
AGGGATATTTCCATAATCCATTAAACTGTACGGTGTTTATAATCAAAATAGACGTATCGG
GCATATAATGTAAAAAGTTAACAATATTTGTTTTTTTATAAACCCATTCATTAATAGATC
TCCGTATAGGTTCTGCGTGACTCGCGAGATCCGCGAGTATCACATCAATTCCCATATCAT
TCATAGATGTTACGAATGCGGAATGTATAGGTAGGTGAGAATCCACATACACTTTTGTAA
TATTATGAATATGATTTTTCCGTATAGGGGAATATGCGCTTCCTATATATTTACTCAATT
CATTTTTTGTTTCTCTTTCAGAACCTAAATATAATACATGCAGGAAGGCTTTTAACGATT
CTGGAGAAAAAACAATGTTGAATCTGTGTAAGGATTTCAAGATACAGAACCCCAAATCCA
ACATTATATTATTATTTAAAATATAATACTTTTTCATCAAATTTATAATTCATCATAATA
AAAAATTTTCTTTATGTGTTCATGTTGATGCTTATTATATTTCGATCTGTCAAATGATCC
ATGATGGCAAGGTTTTAGATATTTATTATGATTTTCTACCGTCCCAAATCCACAAGTTAA
TTTCCCAATATTGCTTGAAAAGATGTATTTAGAGGCGACGGGTTTCAATTTCTTTTCACA
AAGCGATCTAACTTGAACCAAAGATGAACTATGTTGAATACACGTATTATCTATTTTAAT
GGTAACTTCCACCTCACTTTCACCAAACTCATGCTTTTCTTGTCTATATGTTAATTCACT
ACTCACTTCATCACAAGACACTATTACGTGTATTTTTTTAGAACATTTTGGTGCTAGTTC
TATATGTGACAAATTTCTGGTGTACATTTCTGTATATACATATCTGCCTAATCCGTATAC
TGCTTCATCTACATTTTTTACAATAAATTCATTCGTATTTGTGTCATCACATTCGTCATG
GATGAAAATTCTAAACCCATTACCCTCTTTTATTAGACCTCCTGGTCCGTATACCATGTT
ACATCCAGTATTGGAGGCTTTAAAATCATCTATTGTAGTGATGCATAACCCTACCTCTAT
TTCCCATGTTGTTTCTTCATCTTCATTACATCTTTGAATAGCTATAGAATTAGAATAATG
AATCAATCCTATAAAATTTAAAAGAAGAAGTAGTAGTGTATTATCCATTTCGATTCGATG
CGATGCAACAGAATCGACTGCCGTATTAAATGGAGTATAAATTCATTTTTATCCGAATAG
TCCTGAAAAAAATCCTTTTTTCGGAGGTTCCTCCTTCTTAAACGGGTTCAAATAACTTAA
GAATCCCGAAGTTTTTGGCTGTGGCTTTCCTCCAAATATATTCCAACTATCTATAGATAG
CATTTTCATAGGTGATAATAAATTTGGAAAGTCCAATATATTATTTATTTTATTTTATAT
TAATAATCTTTTTTAAATTCGAAAAATATTTGTAATAAACAATAAAACAAATTATAGTTT
ATTTACCATATTATATCTAATTCACAAAAATTCATACATTCTTTATCATCATGTGTATCA
CAATAACATCTTTTTGTTCGTTTATGGGGTATATTGGAATCAGGTTTATTAATATTATCA
TCGATTGAAGATATATAACTTTCGTCATTCTCACAACAACATAACATAATAGAAGAAGTA
AGTAAAATAATAGGCAATATTTTACTATCCATTATAATTTTTATAAAATAGGCTTTAATT
TTAAATATTTTTGTGATTTAATTAAATGGAAAAATAACATTTAATTATCTTAAAATTTAT
ATAGTGAATTTCAGAATTACAGTCTCCAGAAAGGACATAATAATCTATATTTTCATTTAT
TATTTTATCCGTAACATTTTTAACTATTTCTTCTAAAAATGTATAATCATTATTATTCAT
CGGATACCACATATCTTTATTTACTTTACTTAATGTGTTCCATGCTATATTTTTATTATC
TTCATTTTTGAGGTAATAAAAGTATTCCTTAATATCTTGATAATTGAAGGCTACTTCCAT
ACACATATCATCAAAGCTTTCATCCACTATTCTTTTCTTTATAACTTTGGAATATAAATT
TACTAATAAACATTTACCGGACCTATCCAATATGATACCAAAATTATCTACTTCTGCCAA
ATGATTATTAATTATTATATAACAATAGCATAATTCTTTATTATTTTCTGATTTATGAAA
TGTTATTAATCTATCTAAATATGGAATAGTAAATAATATATCATCTGCAATTTTATATTT
TATGATCACATTAAATAATGCTACAATCTTAATTCCTTCCTTTACGATTGTGGATTTATG
TATCAAGGTTTTATCGAATAATACATTTTCTTTTGTAGCTATTGAAGTATCATCATTTAA
GAATATTTTTGTTTTACCACCATTTTTTGGTTTTTGTATATATAAAATTAAATGATATTC
TTCACAGTCATGAGATCTTAATTGAATAAAATCTGTATGATTGTCAAAATGATCACCGCA
ATCATATTTTACAAATGTAATATGTTTATCTACTATAATTTTTTCAATTATCTTATTATT
ATTAAATTCATCAAGTAATTTATTTCTGACACGTTCAATGACATCATCATTATCAATAAT
AATTTGTTTTGATTTTCTTTTATATATATCAATATGCTCCCCTTCTTCATATACATTATA
TATTTTTGAAGGATACCATTTATCATCATTTGATTTTATTATAGCATTTAAACAATCTAA
TATATCGGAGAAACAATTATTTTTAAAAATATTCACCGTTATTTTATCCAAATTATTATT
GATATACATATTTGTTTATTATTTTTTTTTAAAAAAAATTATTTTTTTTTTATGTTTTAT
TTTATCATTTAATCTTCTTCATCATCAATGGATGATTTAACATCTCCTTGATATTGCATG
ATGGGTTCTGGTCCATTACAACCCTCCTCACACCTATGTATGGAGGGTTGTATAGTACTA
TGAAATCCAACACATACTATTTTGTTTGACATATCAGTAGGTACAACAATACTAGGGGTA
GATGCAAATACTAATGCGGTTTCATTAATTATTCGTGTATTTGTTGGAAATCCTGGTTCT
CCTGGATTATAATCTGTATCTACAATTAACTCTGTAAAATATCTAGACCATCTATAAGTA
GGTGCCAAATCTTCTAGATTATACCATTTAGCAGCAACAGAAGAAGGATTATGTTTATCA
AAATCACAAAATAATGTTGTATTTTCTCCTTTCTCTTTACCAGTTACCTTTATCTTAGGT
TCTACAGGAGATGGAATATTACCTTTTGCCAATTTCCAATAATCATTTGCTGTAATACCA
CACGTCACTGCAACAATAGAACCAAAATATTTCATTATATCATTCCAAAATGGAGATGTG
ACGGTCAACATACCCACTTTTGGAAATGTATGAGATTTTACCTTTGTAAATCTCTTATTT
TTTGTATCAAATCTAGTTAATATTTTACCATCAACTTCTACATAACCAAATTGTGTATAT
AACTGAATTAAATCTGTACAACCAACTATCAGTGAAATACTTTCATGTTTATTTCCTTCA
AGTTTATTGATTTCAGAAAGAGTGTTTTCTAATTGTCCAAGCCAAAAACTATAATGATAA
TCATCCTTTGGATAATGTTTAATTTTTGTTTCATTAAACCATTTAGGAATTGTATGTTTT
TGTTCCGGTCTTCCGGTTTCATGGTTTAATTTATAATGTTTTATTAATACATTATTAAAT
GTATCCGTGACATCAAATTCTTTCTTTCCTGTAGTTTTATCATATCTAGTAAATGTATAA
TTATATACCAGATATCTGGCTGCCTCTGAGTATGCTATTATAGAAAGTAGAATTAAAATT
AGTTTTTTCATATTTTGTTATTTTATATAATTAACATCATATTTCAATTATATTTTAACT
TTGTTATAAAAAACTTTTTAAATATTAGTCGATGTCGAATACTAACTTCTGCAAAGAAAA
TGCTTGAAAAATCTATATCATAATTTATTTTGTTGGCTATCAATCCTATTAATCCTATTG
TAGCTTTACAATGAGTTAATATATCCCCATTAAATTTTTCGTGTATGTCTAAATATTGTA
TTTTTTGTTGAGTAAACATAGATACGTAGTGATCTATATTTTTATAATAAATATATGCAA
TATTATCATATTTTAATAATTCTTTAAATATTTTTCCACATTGTATTTGGTTTCCATATT
TGATAGATTTTCTCCATTGAAAATACAGATAGATTATATCATCTATACTATGATGATTTT
CTAATTTATCTAAAATAATATAATTGATTTTTTTATTTGAATATTTTGATTTTTCTAATA
CATCTTTCGATTCTTTCTCTATGATAGTATGTATATTAAGTTTATTAGGTATTACTTTTA
TTATATCATAAAATAGTCGTAAATCGCATAAATAAAATTCTTCTTCAAAAATTTTTATTA
CTTCCTTTTTTGTTGGATCTTTATCATGACGTGAAAAATCTGTATTTTCTTTAAAGATGA
TACAAAATTGTTTAAATTCATCTATAGAAAGTTTTTTCAAATATTTTCGTATTATCCTTC
CGGATCTATAATCCTTTATAAAATTTTTCACTATAACGCACGATGATGGTACCGTCATCT
TCCAGAGAAGTTGGTTTACAATTCAATTAATTTGATTGATTGAGATTATTTATAAAATTT
TTCACTACAATTATAATATAATAAAAATAAAATTAATTTTCACCAATATCTAACAACATT
TCATCAAGCAAAGATAAGATTAATTCATATACTTTAAGCTTTGGCCCGCATTTCTTTTTG
TATTTTTTATCTACAACATTTTTTACTCTTTCTTTTAAGTATGGAATATCATTTCTTGAT
TTTAGCACACATATATCAACTGGTGGTGGATTTATAGATCCTACACAAACGGTTTCTGAA
GGTTCTGTAATTTTGGGATAATAATCATTTTTATCTTCACCAATAACATTGATACAAACA
TTTTGATAGCTTTCAAAAATTATTTTACATTGATATTTGTTACAATAATAATCACTGATT
TTGTAATATATAGGTTCGTTGTCACCAAATGTAATATTCGCGGTATATGTAAGAAGCGTA
TTACATAGTTTATCATTTTCATAAATTGGTACCTTTTTTCCTTTGATGATAGCTGTTGGA
TGCTTAATGGTTAATATGATTGATCCGGTTGAATCTTTTCTTTCTAAAGTAATATTGGGT
GGATTAATAATCACAATAGAACATACTGACTTCAAATTTTGTGTAAATTCTTCTAAATCT
TTATTAATTAATTTTACCCATATATCCATTTCATTATCGTTTATTTTATCAGAAACATCA
CATATACCAAATGAATTTGTACAAACAGTTCTCCAACTTGTTTCATAATTATTTATAGAT
ACATTATATTTATCTTTATTATCATTCCATTTTATTATTGTATCAAAATCATAAGATTCA
AAATGTATATTATTTGGTTTTGATAAGGCTGAAGCAATAAAGAATGAAACTAAAATCATT
GATTTAATCATGTTGGTTTTAAAATATGACAAGTTTTTTTTTAGTTTTTTTTCTGATAAA
AATTTTAAATTATGGAAACATTGAACATAAATATTTATCAAATTGATTTCGTTTTATGTA
ACTTATGTCATCAAAAAATATATTATAACAAGGATATGCTCCTTTATCGTATTTTGAAAT
TATTGATACTAATCCAATCATGCGTTTAATTGATTCTATATCTATTTTAATGTTATCATC
GTATGTTCTTTTAAACCGTTTGAATAATGTAAAACTATACTTTCTATCGCTTGTAGTCTC
AAGATTTGTAATTGATGTATTTATATAATTGTTACCATAATGATCAATTGCCATTTTATC
ATATGTTAATAGCTCACTATATATTTTTCCTATAGGTACGTCATTAAAATCAACATCCTC
ATTGTTTTTTCTATACATAAAATATACCTCCATCATGTTGTTAAAGTCATCTACATCACT
CATTGAATTAATATATTTATACTCTTTCCAAACTTTAAACGGTATAATTGTAACATTATA
TATTCCATCGTTGATTAGCTCATATACAAGTTTCCTATTTTCATATAGTATATTTGAAAC
AAACTTTATTATTGAAAAAGATAATTTATCATCCGTTTCTGTTAAAAAATCAATCATTAA
TTCTTTTGATACACGATCGTGCTTTGAAAAATAAAATATTTCTTTGAATAGAGTTCTTAG
TTTTTCTTCATCTACTTCACATATTAGGCATATATATTTTTGCATGAGTTTATTTTTCTG
TTCGTAATTCATTTTTTAAAAAAAAACTATATTTATTTTCAGTTTTATAATTATTATACT
AATTTATCAACTTGTATAATTAAGTATTTATTAATATTTTGCTTATGATATTTTATATAT
ATGATTACCAAAAAAATGCATGATATCATGACTATTACAAATGGTATCAAATAAATTGTA
AAAACTACAAATTTTAACATGGTGTACTGATTTTTTATTATTTCTTTTATATCAAGTTTA
ATTATAAAACATATAGATATAAACAATGAAACCAAAAAAGTAATAACAAAGTAGTGTGAC
CAATCGCTAATACGTTTTTCAATGGTATCATTATAAATATAATATACAGCTGTTTTCTTG
GTAGTCCTTACCATCGTTATTATATTTAACAAATACATCCTTTTTCATGTTTTTCTTAAT
TAATAGATTTATTATTTTTAAATTAAAAAATTTCCCCATAAACGCATAAATTAATGGATT
TATGCAACAATGAGATAGTGCTATAGTTTCAGTAATAAATATACTATAATATATACCTTT
CATAGTATTACATCCATCTATTATATGAAGATAATGTAGTGATAAAGCAAATATTGAGAT
ATTGAATGGTACCCAAAAAATTAGTGTTAAACACACGATGATACAAATTAATTTTATTGC
CTCATTATTTTTATTATTGATATTCATTCTTTTCAAATAAATTATCATTTTGACATAACA
GTATAACAAGATAGTAATTGGTATTAACATTCCCAATATATTTACTTCAAAATTTATAAA
TATTTTCCAATTATTAGTTCCATCATAATATGGAAAACATTCCAATGTGTTATGTTCTTT
TTTTACATTAAAGGAAATGAACATCGGAATAGTTGCGATAATAGAAATTAACCATATAAT
TATACTAATTATAGATGCGTATTTTACAGTATTCATCTTTGTTGATATACACGGATATGC
TATTGAAATATATCTATCTACACTCATTATTGATATAAATAACATAGTATTGTAAAATCC
TATATAGTATATACCAGATACAAGTTTGCATATAAAGGTACCAAATGACCATTCTTGTAA
TATATAAAATATATAAAATGGTAATAATGAAACAAATAAAATATCAGACGTTGCAAGGTT
TAATAAATATACATCTTCTGATGTTCTAATTTTTGATCGAGTGAGCACATAAATTATAAT
AAAATTACTAACTAATCCGAAGAAGAAGAATGTTGAATATGCTAAGATTAATATTGTATT
TTTATGAGGTATTTCATGATTACAAGGCTCATACGATTCATCATATTCGTAATCATATCC
CTCATCCGTAGTACTATTTATAATAGAAGTTAGTGTGGTTGCATACATCATATTATATAT
TTCAAAATACTAACATTATTTTTATTTTTTGAGAAAAATATATTTAATCCTTATTAAAAA
TAATATCTCTATTTTTTGAAATATCGATGCAATTTAAACCCATATTATTACATTCTTCAT
AATCCAAACCAATAGAGAGAAGAAAATCAACAATTTTTTGATCATCGTGATACATCAAAT
AGGTATACAATATATTATTTTGATGTTTATCTTTATTAAACGGAGAATTACCCATCTCAA
TTAGAAATTTCATTATTTCAACATTAATGCTGATATTGTCTAAATATACATGAAGCAAAT
TTTTTCCATCTGAATTGATTTCATTTATATTGGCATTTGCTTCGATTAAAATTTTTAATA
TTTCTTCAGATATATTTTTATTATATGTAAGATAGTAACTTAATAAACTAATATTATCTC
CAGGAATAATACAATTTACATTTGCACCATTTTCAATTAAAAGTTTCAGTATATTTTTAT
TTACATATTCTTTATCCAAACATGATAAAATCGGAGGTTCATTAAAATCATTATTTTCAT
TACTAAGATTAATCCATTTTTTAACACCTTCTTCATCATCACTTTCTATATAATAGAACA
AAGGATTAGAATATTTTGAAAACATATAATCCACTTGATCCATGAAATCACATTCTTTGC
TCATCATGTCCATTATTGTATGGCAAAATTATTCACCACTAAAAAAAGTCATAATATTTC
ATTTATATTATAGTTACTTTATATTCTTTTGTTATATTATAATTATTACTATTATATGCA
AATAATAATGTACATACATATGAACCAGAATCAGAATTTGTTGCTGAATTAATGGTTAAA
GTAGAATTATCATTACTAAGATGTATATGTTCTGTTCCATATATAATAATTCCATTAAAG
GACCAAGTTAATGTATAATCATCTTTGAATGTGGTTTGTATGCCGCGTGTTCCATAACAT
GCGAGTTTTATATCTTTACCTGAATGGAATTGAAAATTATATAAACCACTATCAACACTA
AATCTTATGGTTGATTCTTCACAAATATTACCATTACTAATTGTGCAAATATAAATACCT
TCATTTGATTTTTTAGAATTTCCTATCCATAAATTTTCGCTCCTATCACCTATTTCATTA
TGTGTAATAGTCTTTATTTTAGTACGTGCTCCAGAATCTCTAACAAATGCCAAGGAATCT
GTTTTTGACCATGTTACATTATAATCAGTAATAAATGTTTTATCATAAAACTTCGATCTT
TTAGAATGTTTTCCTGTACAAAGTAAAACCATAGGATCTCCATCTTTTGCATATGATGGA
ATTAAATCTCCTCCTCTATATTGACATGATAAACATAAGCAATTAATAAATTGTAATAAT
ATGAAAAATATTATCAAAATCATAATTGATTATTTTATTACTATCTTCTTCAGCTTTTTA
TTGTTTATTTTTAATTTTATTTATTTAGGGCATGTATTTGGTAATAATCCAGAAATGTCA
GATATTGTTCCATATATAATTGATGACGTATCTCTAACACTTCCATAATCATATGTTACA
TCAGCTTTAATACCATCAATACATTTGCCATATAATATGAGTTTTTCGATATGATCTGCA
TGTTTTTGTTTTTTAGGTTTAAACCTTTGTGGTGTCATTACTAAATTATTATCATCTCCA
TCACATGTTATTATAATTCTAACAATGCATCTACTATCAAAATTTAATCCTTTATATTTC
ATAATAATTGGTGTGAAATATCCTAATTCCATAGTATTATTTCTAACATTTGTATAATAT
CCCTCTGTAAATCCTGCATCGCCACAATCAGATAATGTAATTGATACATTAAAATTATCT
ATTATATACATAGAATAAAAATTATCATGATCATACCGTTTACATGATACATCATTTATT
AGATTTTTATCATATACTGTCAGATCAACAAACATAGTAAATTTATTTTGGATTTCTTCA
TTTGATACTTTAGATACATGATAACACGTAATAAAAAAAATAAAAGAAGTTAATAATGTA
TACTTAATCATTATTTGATATAGTAAATATTTATTTAATTTGATTTCTTATCACATACAT
AATAATCTATCTTTTCTGTATCTACATCACATTGTCGTTTGCTTGTATTTAAATTTCTCC
ATGTATATCCTCCGCTTGTACCCGAATAAGGTCTGGCTATAATACTATTTGCACTTTTAA
ATCCATATAGGGAGTTTGGATATACATTTAAATCGACGCAGGTAACACAGGAACCCACTA
TGATTAATTCATTTTTTGTTGATAAATTATCTATATTTTGCCTTTTAGAAACGATATCAC
AATCTACATCTAAACAGGTAATAGTCACTTTTGTATCTGGAATAGAATTATTTGCATTTG
ACGATCTATCATCCGCCATAAATATTAAAATCACTAATGTATTATTTACAAAACCTTCTG
CTGAAGCAACTAGGGGTTTCGTAATTTCAGTAGTGAATTCAAAATCTACATTTATCCCAT
ATCCTGTAATAGATATATGACTATTTGAAATAATATCAATTTTACACTCTTCTTGTTCTT
TAATTGGATAGGTTAAGCCAATAACCAAAGATGATGCTAAATTCCAAAATCTGTATCTGT
GAGAATTGCATTTCCCTAATGAAGAAGAAAGTTTTCCATTCCTATTACTAAGAGGGGAAG
AAAGGCAACTAGAGATGCAGATTGATATTAAAATAAAATAAAATAATTTAGCCATTTTCT
ACCTATACTTTTTTATCAATTTTTATGGATCTCTCACAATACCAGAAAATAGAATCATTT
TAGTTGGTTTATGTTCAATCAAGAACATAAAAGGTCGGTTACAAATAATAGATTTAATAA
CTCGTCTTGGTATCGCCAATATTACAGTTGAGCTTTGTGCAGTCGTACCTGTTTCATCTA
CATCTATTTTGGTTTTTTGTAGGGCTTTAGATACATAAATCTCTTCCTTCGTCATAGTTG
TAAAATCAGCCAAATCTTTATCAAAAATATTTTTAATACCCATTTTACTTAATACATCTT
TGAGATCAATATTTGATTCTATTGAAAATCTAGGCAAATATATTTGACAAAAATCTTCTT
TCATGTTCTTTTTCCAAAAATCTATAAGGTTGTAATGTAAACTATTTGATATATGATGTA
TAGCCATATTTTTATCTTGTGGCACTATCACAAACATCGAAATGGATTCGTCTTTATATG
GTAATTCTATGACATCGTATTTTATTGCGGGATAGCCGGGAATATCAAATGTGCCAACAT
TAAAAACATTTGTTTGAGCCATCATTTTTACCATCTTTATGGATCCTCCCTCTTTATAGA
ATTGCATATCGAATGTATTCTGTTTTGGAAATATATTTTTCCAATTTCCATTAAAATAGA
TCGCATTTATCAATAACATTTTTAAATCTTCGGTAATTGTATCTTTTTTAATAACATCTT
TAATCGTATTATTTGTTTTCTTTTGTATGTAATCGTTAATTATATAGGTAGCCTGTTTGG
TATTTTTGAAAAATACTTGTTTAATCGTATTATTAAAAATATTTTTAAATCTTTTCATAA
ATTTTTTATATATTACCATATTTCTTTCTACAAATACTTCGTTAGCCATATTAATAGAAT
CTATAATTAGCATTTTTTCTATAAATGGTTTTTTAACCTCCATTCCCATCGCCGTCACTA
TTTCCATTTTACTATTACCATGTGTTGCTATTTGCATCATCGACATTGCCATAGTTAAAC
TATATGGAGAAAATACTATATTATTTTTATCATCATCCGAATATTTAAACCCCGTTATTC
CAAAATTTATCACGCTTACATTTTTTTGACAATATATATTTTTTTGTAGTAGATATAATA
TAAAAAATATAAATAAGTATTTCTTTTTCATTATTTATTTATAATCAATCACTGATAATT
AAGTATTGATTTTAAAGTTTCGTTTGATAAGTAATTTATAATCATATATTTTATTTCCAT
TGGGAAAGCGGCCCATGCCGTATCTTTACATAGATTATCAAAATAATCTATAGATTTTTT
AATTATATCGTATCTAACTTTTGCTAAATGTATTAATATTTTAAAATAAATCCCATAGTT
GGATAATGCAGTAAGTTTAGTAAAACTTTTATTTTTTATATGTTTTAATGCAATATCGAT
ATTATTATATTTAATAATGCTATATGCCGATATTTTCTCATATCCGATATATATATTTTT
TAATAAATTAATTTCTTTATGACAATTATTTATATGATCCATTAAAAATGTGTAATTATT
ATTTTCTCTTTTATAAAATTGTTGATCCAATAATAGTGTATATGATATAGATTTTTTTAA
CATTCTAGTACTATAATATTTTTTAACCTTTTTAAAGGATTTTATCATCGTCATATATGA
AGGTCTCGCACTTATCAAAATTGTCAGCATGCTTTCATTTAACAAATCAAAACATTCGGT
TATACATGTAGAACCATCATTGGTAATTGTATCTATACAGGTAGATTTTTGTTTTAAAAG
AAATTTAACAGAATTAATTTTATTATATCTTATTGCTTTATGTAATGCTGATTCTCCATT
ATGATTTACAGTATCTGAAATGCCCAAATTGGATAAAATCTTTAAATTATTTACATTATT
TATAGCTTCATGAAATGGTGTATTTCCATATTTATCCATAGCGTATATGTCTCCTCCTCT
TTCTATTATTAATTTAAATATTTCTGAATTTTTATTTCTTGCACTTATATGTACTGGAGT
ATATCCTGTTATTGTTTTATCATTTGGATTAGCTCCACAATCTAGCAATGTTTTTATTAT
ATTTATATTTGGATTTATAGCAAAATTATGTATAGCAGAATATCCATAAATATTTTTATT
ATTAATATCTACACCATTTTCAATGAACATATTTACTATTTCTTCCGTAATATCTAAACT
ACAAGATATAATATTAAAAGGTTGTTTATGGTATTTATTTTTTATATTTATATCTATACC
ATTATCAAAAAATATTTTTAAAACATCAAGATTAAATTTTTCTGGATATTCATACATATA
ATTATGAAAAGGTGTATTGCCTTCATTATTTTGAATATTTATATCTGCACCATTCTCTAA
TAGTAATTTAATAAGTTCTTCATTGGGATTTAAACAACAAATTTTATGAAGAGGAGTATC
TCCATCATCATTTATGGTATTAGGACTTAAACCTAATTCTAATAATAACTTAACCTTTTC
TAGGATATTCTTTGAATCATGATAGCAATGTAATAATGTATCATTATTTTTTGTTAATAT
AAAAGGATTTGCCCCTCTATCTAATAATACCTTAGCTATGGATATATTCCCCTTTTCTAT
AGCAATGGTTAATGGAGTTTTTCCACAATTATTGCATTCATCAATATTATTAATCTTATT
AATGAATAGATTTAAAATTTTCACATCCGTTAAATTAGATTCTGTAAATGCATGTAATAG
ATTTTCATTTGAACTTGTCTTGATATTAACATCAGCACCATTATCCAATAATGTTTTTAT
CATATCTATGCTTGTTCTTTTTGTTATCATATAATAGTATAATGGAGTACATCCATATTT
ATCTATGACATTGATATTGGCACCTCTTTCTAACAATAGTTTAACTATATTCACATTATC
TGTTATTGTTGAATAATGCAATAATGATAATGAATTGCTAGTAATTTGATTTATATCATA
TCCATTATCTAATATTGATTTTACTTTATCCATGTTATTAAAAAAATGTAGATTACGACT
ATAATATAATGGATGATTTATTGATTCTCTAGTTCTATATATATAAAATATTGATGACAT
TTATATACTTGTAACTTTTCTTACATCTATATATCCTTTAACTTTATCCGTGCGAATTAC
TTTTACCTTAATAACCTTACCAACTAATTTTTTTCTTATTTTTTCAAATCTTTCCTGATT
CACATTCCAATAATCTACTATGAATCCATCGAGTCCATAATCTATTAATTTTACATACAA
TTCACCATTTTTTAAAATTACTATACCTTTTGTCAATTCATCTATTTCTGGAAAGACGTA
ACAGAATGCCAAATCGCTTTTTCGCGACATGGCTACACATAAAAATGAGCTATTTCTTCA
AAATTATATAATGCTAAGGTAATGAATAACTACTAGTATTGAAACAATCCCATATGTTTT
GTAAAATGATAGTTTCTTTAAGTGGCGTTTTTAAATCAACTAATACACATGATATTTTTG
TATGTTTCATTTCTTCGGTAATATTTTTTAGTGTTAAATATGCCTCTGGTAGATTATAAC
AATCCGTTTTCTTTGTCGGAATTTGTAAATTTTCACTATAATGATTTTTATCCGCTTGGT
TCACAAGCATATTATCTCCTATTATCCAATAAACATAACCATATTGCTTAAAATAAGTAG
TTCCTCTGCATTCTAAAATAGTTTCTTCCGTTTGTTTAGTAGGTACATGTATAACTAGAT
CTCTTTTCTTAACACAATCATTTTTGCCATAAACGGCTGTAAAATAAATAATTGAAAAGA
TTAATATACCTTTTATCATTTTATATTATATTTTAATACTAAAATATAGATTTCAATAAA
TATTTACAAATATAATAAGCAGTAATACCTAATATAGCTCCAAATATGGTAATTTTTAGA
TAATTGGTTATTAATACATAATCATCAACTATATCGTCATCGTCACGGTCTATAAAATCT
ATAAAGTCTTTACCATTATTAGATATTTTTTCCACTATTTCATTTGATAATATCTCCATT
ATCTTCGTACGATTCTTTTCTCCCCATTTTTCAGCAATCAATGATATAAATGATAGTGTT
GCTAACTTAACAGATGGTCTGGAATCGATCAATAATGATTCAATAATCTTTGATTTTATA
TCAGAGGTAGTAATATCATTTATGTTTATTTGATTATACATAGAATTGAAATCTAGTTCA
TAATTTTTTTTTATATATTCACAACTCTTATAAATACGATCAAGTATACTTTTCTCATAA
TTATTTAATAATCTTTTTTCACCCATAGTGCAAATATCATTTATATAAATATTTAAAAGC
TTTTTAACTATTTCATCAAATTCAATAGCAGCTTCCATATTATTTATAAATATATTCAAC
TTTATATTTATGTTTATTTCAAAAAAATTAATTTAAACCGCTTGATCCAAAACCTCTATT
TCCTCTAAACGTATCTTTTAATTCCAAAACTTCTTCTATAGATGGATTTTCTATACGTTC
AAATATTATTTGTGCTATTCTATCACCAGTTTTTATTTCAAATACACAAGTGCTATTATT
GATAACAATAACACCTATATTCCCTCTATAATCTCTATCAATGACACCACCACCAATATC
AATATTATAATTTAAAGCTAATCCTGATCTAGGAGCTATTCTACCATAACAACATTCTGG
TATTTCGAGGCTTATATCTGTTCTTACAAGAATCCTATCAAATGGATTTACTGTATAATC
ATAAGCGCTGTATAAATCATATCCGGCAGAGTTATATGTTGCTTTTTTTGGTATGGTGGC
GAATTCAGATAGCTTAAGACATTTTACAGTTATATCTGACATTTTATATAAAATTTTTAT
CCTTTTTATGTTTTTTAAAATAATCTTCTTTTCTCAGAACAGCTTAGCCTTTTTAATACT
TCCATATTTCTAAACCTATGTTTTCTCTTAATAGTATGTTGAGTTTTTCCAAATGTTATA
TCACTCTGTTCCAAATATTTCCTGTTAAATCTTTTTATGTAATCCGATAACTGTTTTTTA
ACAAATTCAGTATCAGGCATTTCTTTAAAAATGTTTAATAGAAAATACAACGATCTAATA
TCTTTATATTTTTTAATGAGTTTTTCTGCCAAGTCTATTCTGTCCATAGTTAGTTTTTCT
TCTTCTTCTATATATAATTCATCTTGTACGATAAATATAACCATTTTGAATTGATATCTA
TTAATATTCTCTAGCACGGCAATTATTGCCGACCTCAATTCCATTTTGGTGATATATTAT
AATCGTGTATAAAAGAATTATTTTTTCATTTTCTCAATACATCGTCTACCTCTATTGATC
CAGCCACTACCCATTGATTTACATCGTCGCTAAATACCTCTATTTCACTAATATATTTAT
TACAAAATCCGCCTATCACCATAATAGAATCTTCAAATTCACATACCGAGGCATTAAATC
TAGGTCTATTAAGTGATGCTTCTATAGACCATTTACATATCACAGGATCATAGCTTTCAA
CAATATTAAACACTTCGATATTATCAATATATGATATTCCTCCTATAACATAGAGTTTTT
CATGATAATAGATAATACAACCACCATAATGTGAATATCTAGTAGGTGTTCCCATTTTCC
ATACATTTGTAAAAGGTGAAAAAATTTCTACAGTTTTATCATTCTCCATTATTCCACCGA
TCACATAAATTAAATTATCAATAACACAAACACAAGAATTATATCTTGGATAATTTAAAT
CTGTCTCTAATCTCCATTTCTTTTCTCCCGGACTCCAGCTCTCAACTGCTTTTAATGGAA
ATTCATCTATTCCTCCTATCACATAAATTCTATTTTTAAACGCTACAACAGCTGGACATT
TTCTTGGATATAATAAATTTGGAACCTCTATTTTATCCGATGTATTTATATTAATTCCTA
TAACTTTATTACTAGATACCATTCTATCTATCATTCCTCCAATTAGGAAAACAATATTAT
TTAATAAAACGGATCCACAATATGGAAAATGGCCATCTACTATTTTATTAATCTTACTAA
TTTTATCATATGCGGTTACATCCTGAATATGATTAATTCCATGTTCATCAAATGTTATCA
TATTTAATGATGGAGCTGTAGGCATATCATAATTACAATATGATTTTCTTGGATATATAT
TTATTCCATCGCTAAAATTAATTATCTGGGAATTTTTCATCTTTAATAGCCAATTATTTA
ATTTTTTAATTCCATCTTTTGTTAAAAATTTAGGTCTTAATATTTCCTGTATCAAATATA
AAGATCTCTTACGATTATTTTTTTTAAATTTTGACCATTTTATAATAAAATCAAGTATTG
TATCTTCACTGTATACATAGACATCGCTACTCTTTAATATTATTTTTAATTCTGTACTAG
TAAGTGGTAATAGTAAACTAGTTGATTCGAGTATATTAAACCTTCTACGTATATAATCTA
TTGCTAAACTATATAATTTATAATATCCGTGAAAAAATCCCAGTCTAAAATATTTAACGC
ATTTATTGTCATCAATATATTTTGTGATAAAATTTATACATGAATCACTTATAAATTCTA
TAGATGTTTTACATGAAAAAATGAATAAATCCGTAACATTATTATTATTTATATAAATTT
TTCCATCATAAATATATTGTAATATATATTTGAAAATATTATAATCTATATATAAATTTA
TATCATTTGATTTGTCTAATATAGTTCTGAAATAATTTGATAACTCTTGTAATAATATTT
TACGTATTCCTACAGTAGCTCCTATCATAGACACGTTACATATTGTTTGATCGTTATTAT
ATTCCAACACAAATTTAGATTTTGATATATAACTATCATCGATATATAATTCCATGATTT
ATTTTTAATTATTCTCTATTATTTCTTTAAACACGAATATTTATTCAGCTTTATAAAAAT
ATTTATTTAAAAATCAGCATCTAATGAGAAAACATTATCTTCTTTTTTTGACATAATTCC
CATTTTTTGATAATCACTAACTCTTTTTTCGAAAAAATTTGTCTTTCCTTCCAATGATAT
AGATTCCATAAAATCAAATGGATTTTCAGATTTAAATATTTTATTACAACCCAGTTCTGA
TAATAATCTATCTGCTACAAATTCTATATATTGACACATTAATTCACAATTCATACCGAT
CAATTTTACAGGAAGAGCTTTTGTCAAAAAAGATTTTTCTATAGAGACGGCTTCAACAAT
TATATTTATTATCCTAGATGTACTAGGGGGATACAATAATTGTTTAAACATCAAACATGC
AAAATCACAATGCAAACCTTCATCCCTACTTATTAATTCATTAGAAAATGTTAAACCGGG
CATTAATCCTCTCTTTTTTAACCAAAATATTGACGCAAATGCTCCTGAAAAGAAAATGCC
CTCAACGGCAGCAAATGCAACTAATCGTTCACCGTATGTAGATTCTTTATCCAATATCCA
TTTTTCTGCCCATTTTGCCTTTTCTTTAATACAATCAATTGTATCAATAGCTTTTAAAAG
ATGATTTTTTTCATCTACATCGGTTATGTATGTATCTATCAATAAACTATACATTTCAGA
ATGTATATTTTCTATCGCTATCTGAAATCCGTAAAAACATCTTGCCTCTGAACATTGAAC
CTCGGAATAAAATCGTTGAGCCAAGTTTTCATTTACTATTCCATCACTGGCGGCAAAAAA
TGCCAATATATTTTTTATAAAATATCGTTCGTTATCTGTTAATTTTTTCCAATCTAATAA
ATCTTTTGATAAATCTACTTCTTCAGTTGTCCAAAAGCTAGCAATAGCCTTTTTATACAT
AATCCAGATATCATTATATATTATTGGAAATATTACAAACCTGTTATTTGATTCAACTAA
AAGTGGTTCCATTGATAAAAAATATTATTTTTTACATATTTATTCAACATCTATACCTAA
CACTTCTCGTTCGTCAGTGTAATATACCCCATCAAGCCTAGTAAAATGAGTTTTTGATAA
TGACAGTATTTTTAATACCTGTGTTTTAAATCTATTACATGCATCCTTTACTAATGACCA
ATCTACTAAATATATTAATAGATAGACTAATATACATACAACAAATATAAATATTGTAAA
AACCAATATTGTTCCAAAATTTATTTGCATATAGTAATAATTATCCACTGATAAAGTCGT
TAATGGAGTCATAGTCGCATTAACCATTTTTGTGATTGCTATTTAAATTAACTACTTTTT
TTTATTTTTTTATCATTATATAAAGACATCATCATTATCATCCATATCCTCATTTATATA
ATATGTAACTCTATAAGGTTTTTTCTTTTTTTTATTCGTTACCTTTTTTACAACCGCGGA
TATTAGCGGTCTTGATTCTCCTCCAGTTGTGCCATTTTTATAAACATATTTATGATGTTT
CTTATACATTTCTGAAGGTTTCAATTCACCATATTTAAATTTGTTGCCTTGAATAATTTC
TTTATCCGTAAGTGTATTTAGCTTATTTTTTATCGTCATAATTAGTTTATTCATATCAAC
GTTATTGATTTATATATAATTTAGTTATTAATTTTTTTAAAAAATATACGGATTTAATAC
TATTGTCATTAGTCTGTATAGGCTTTTTAATATTTAAACAACATCCATATTTCTTTATTT
CATCCTTTGTAGGAGTATTGTATGGTTTTCCACTCACTATTACTTTATTTATTTTTCTTG
CTCGATTTTTATCACTCATGTTTGCTTATTTAGTGAGTATTTATTTATGTTATTAGGTAA
GATTTATGTTTCATTTTTGGTGTAAAATTAAACATATAGATATGGAGAATATTTATATTT
ATAGCTTATTTTACGTTTAATTGAACAAATTCCAAGTATAAATATAAAACAGATAATGAC
AGACCCAATAATAAACCATGGTTTATTATATGGAAGACTATTATATATAGTTGGATCGGG
AACATATCGTTTATTTAAAGCATTCATTACAGCATTCAGTCCGCAATTTGCCTCCGCTGT
TCCAGAATTGATTATTTGAAGCAATATATATTTATCTTCTGGAGCGGAACAATTTCCCAC
ATCGAATGTTTCAATATTTATTATGTTGTTTACATCAGCCGATGCATTACACTGTCTCTC
TAACTCAGATACATATGAAATATCATCATTCTTTAAATCAATTCCTATTTCATCCGCCAA
TTCTTCCCTTTCTTTTTGAGGTAGAATATTTATTATATCCTTAAATGTCTTGATTAATAT
GACAAAACTTAACTTTGGATTATTGAGACATCTATTTATGATTTTAAGTTTACACCTATT
AAATACACCACGTATTTCACCTATGTGAATTCCGCATGTTGTATTTACAGGCACAGAATA
TAATGATAAATTCTGTAAATATCTATCTACAAATAAATTATAAAGTGTATTAATTTTAAC
TTGGTTCTCCTCCATTTATCCAAGGTGAGAAAATGTTTTTTGAAACAAATTTTTCCAAAA
ATGTGATAGGGTGCAATATTGAAACTTTTAATCTAAATTTATCGCATGTATTTTTTGAAC
AACATATTATGAATTCTTCTAATGCATTGTTAAATTCTACATCTTTTTCTATTTCCGGAT
ACGTGCGTAAAAGAGTATGTATAAAAAAATGAAAGTCATAATACCAATTATGTTCCACCT
TTAAACTATTTTTGATTTTTTTATTTACTATGCTAGCAACCTGGGAAAAATCAAAATCAT
TTAAACATGCTTTTATCGGTTCATTAAATATATAGGACATTTCTTTAAATTTTATCTTGA
TAGGTTTATTAGAATCAAACAATAAAATATTATCAGGCTTTAAATCTACATGTAAAAAAT
TATTACAACACGGTAATTCATATATTTTTATATATAATAATGCAATTTGTAAAAAAAGAA
ATTTTATATAGTTTACCAATGATGAAAATCCAAATTCCAATGCCATTTTCTCAGTAATTT
TATCTGCAGAACATCTTGCCAATGGAAATACTATTATATTGCCCCTATCATAAAGATAGT
TTGATCTTTTTTCATGTTCAAAAAAATGAAACATATGAGTAAAATAATTTATAACGTTTA
TATTACTTTGAACTAATAGAGGATAAAAATATGATAATAGTTTTACAAATTTTATATCTC
CCTTTTTTTCATTAAAAGATTTTAAAAAATATTTATGTGAAAAATGATGTAAATTTAATT
GTTGATTATCTATCGTCTGTAACAATAATAATAAAATATACAATACGCGTTTATAAAGAT
TATATAAAAATGTCAATCTATAATTTAATCCCATAGCCCAAGCACATACAATTAATTTTT
TTTCATCGCCCTTTAAATTATTATATAAAAATTTAGGTATTGTATATTCCGCCGTTGTCT
CTATCGGACTATATTGTTTATTGGGTTCATAGACAAACTTTACTACATACTTATCTATTT
TAAATACAATACCATATCCTCCTGTTGATATATGATAAAAATCATCATTCATTGGATAAA
ACCTTTTATCTTTTTGTTGAAAAAATGAGGGATTTACATAATCTTCATTAATTATTTTGT
TTAATGTTTCTCTATTAAAATTTTTAAAATAACTAATTAATTTGCTATTAGGAGACCAAC
TTTGGTTAATATCCAATTGAGAAATTATATAATCAAAATATATATCATCTCCCAAAATTG
TTGTAGTATTTTCTATATCATCTTTATATTCCCATTGACATTCTGGCGAATCCTCATTCA
TGATTCTCATTTATTGTATAAAAAGCATATCATTTATATATATAACCCCACGTTTGATAA
TGCATGTAAATTAGCAATAATTTCAGATTTTACTTTACTACATTCGTTTTCATTAATTAT
TTTAATTATATATGAATTTATTTTAGAATATTGTTCATGATTATGATCTAAGAGATTATT
TATTTCTTGAGATAACAAAGTTAACTCTTCCCACAATTCGTTCATAATTTTATTTTTTCC
TTTTATATCATTTACCATTGATAATTTTATATTATCTATAAAATTATTATCTTTTATTTT
ATTATTAATTTTTTCTATCTGATATTCTAATGCATTCTTTCTATGTGTATCAATAATATC
ATCACTAAATGTTACATGCTTCTCCTCTTTTAAATGTTTATTAGTTTTTTTATAATATGA
ATCATAAATAGATAGGAATTCACTCACTAAATATGATGCGATATAATTTTTCTCTATAGT
TTCTCTTATTTTAATTATTTTATCAACGATGCCAATTATCTTTAATCTCCTACTACAAAT
AATAGATGTTGCCTTTTCAGAAGATTGTGTAATAATAACCGTAGGTACTATAAATCCCAT
ATTTGCTAGTTTTTTACTGGGTATGATACTTACAACAAGATAGATGGCATCCCCTCCTAT
TTGAGGCAAAAATTTTATCCCTCTAGAAGCTCTACTTATAATATAATCACCTACTTCTAC
ATTTATTTTTAAATGTACACTTTTAGGAATATATAATCCTGAAATACCATCATTTTTTAT
ACATATTGTTGCTATAAATCCGTATGAAGAACCTATAAATATCGTACCTTTAGAAAATCC
ATTTCCGTGTCTAAGTCTAACTAAATAAGTGTCCGATATTGATACTAGGCCATCCTTATC
CAAAACAAAATCTATCATTTTATTGTCGATATTTATTTTTTTCCATGAATAAGAGACATT
ATTTATTTCTTCTGTAAAAAACCCATATGTATACGATTCATGTTTAACTATATCGCTTAC
ATCAATAGGTGATTTAAATATTGAAATTTCGTCAGATAGTACATTATCTTTTTTTATATC
TTTTCTTATAAAACAATATTCAGAAGAATCATGATGATTTTTATTTTTAGCTCTATATGA
CTTTTTATTATACCTATATATCATTCGTGAAAACATTGTTTTTGTTCACCCATAAAGCAT
ACTATTAATTCACTTTAATCATCTCCGATAAAAAAAGTTGATCTTTTTTAAACGAATCAT
TTATCCATACTTCTTTATAATTATGTCTAAATACATATTCTCCTAGAAAATGACTATCTA
CTCTTTTTATTATAGAATGAAGTTTCATACGGCAATAACTAGCGGAAAATGCTGCGAATG
GTAACAAATAGTTTGGGAAATAATCTTCTTCTTTGTGTGGAAATAATTCTGAAATATTCA
TAATTTTATCTATTAAATTATCCTCAATATCCTCGATACTTAATTTACCTATATTGTTTA
TTGTATCAAATAAATAATCACTTATATGTACAGAAGATTCCCATTGCAATGCGCCCAATT
CTCTTATTTTATATCCTCCAATCATTCTAGCTAATTCTATATCTACACATGTTAATGGTG
TATAAAATGTATAAGATGGTTCTGTAACATCATCCAAAAATATTATTGGAATTCTAACAT
CTCTTTTTACAGTTACCTCACATAAGGCTATATATAATTTATCGCGTGAACCTTCTTTAA
CATATTTAGGAACACCGATAGGATATTTACAAAATTCTATTAATTTTAATAATGATTTTA
ATCTATAGATAGAATATGTCTTTAAACACTGTGATGTATTTACAGTTTTTACATATTTAG
ATCTTATAGATTGATATATAAAATTAATAGAATCGTTTCCAGTAGGATAATACATGTTGT
TCCCAACTTTACCCGCTGCCATATGCAACACTTTAGTTATAACCATATCTTCCAATTTAT
TAAAAGATAACATAAACCATGGCTGTATTAATACATTTATTGCAGTAAAATGATTATTTA
TTGAATTATATAAAGTTGTAACTGTTTTCAAAGCGCATCGTTCTATTAATTTAATCTTTA
ACTTTGCTTCATGTTTTGTTATTAAATCTTTTGGAGGTGTAATAATTACCCTTTCCCAAT
GGTTACAATATTCTTTCAACGTCATCCCGCAAGAAAAGTTTGCCACATCCAATAATAATA
TTTTTAATCCATCTTTTGATACTATATTATTATATCCTATAAACGTCCACCCCGAATCCT
CCGGCCAAGATGCACGCAAAAGAGAAAAGTCAAATATACTACTTAAATATCCAACCATCG
CGATGGTTGATACATTATTCATAGTTTCCCTAACCCATTTTAGGAATTCAGAAATTAATT
TCTTTGAATCAAAATCAATAAAACATTTACCAGGATATACGCTTATCATATAAATAGATG
GACCCGTTGGGGTAATTATAGCATTCACATATATGGAAAATATTTTCAAAAAATGTCTAT
TATAAGGATATATCTTGGACCACATATTTTTTTGTGAAATTGATTGGATATCATAGGGAA
GAATATCCAATTCTGGTCTTGTATAAGATAGTTTATCTTTCACCCAAATATAATGATTAC
CTATATACGTAATAATCATTTCATCTATCAATGTATAGCTAGTTTCTTTTATCTTATCAT
CTCTATAATTCATAAATCTATATTTTGCCAACCCATTACAGCACATCCAATAATTAATTT
CAGAAACCGTTACATTACCCTTAATGTCTAATTTTTTTATATTATTTTCAATCTCCTTTT
CAGAAGATGCCCTTTTTATTAATATATCTATTAATGGAGATCTAGCTGTGGCAGGGGAAT
AATAATTATCCGATTCAGATTCATCTATAAATAGCTTGCTTATAGGACCCATAGGTGGAG
GACATGGTTCCACATATTTGGTGATTCCGGCAATTTCCAAAGTAGTTAAATCTATCATAG
ATTTAACCATGGATAAATTACTAGAATACACAATAATGCCCTTGCCGCATTTTGTCCTAG
CTAATACTATTGAAAATTTATATTCTTCTAATGCAGTTATTATATGATTATTTTCATCAT
CATTATTATCATCGGATAATGATTTAAATATTTGTTTAAACATATTTGTTTTTATATTAA
ACTTTTATATAACTTTCATTTTCAATTTATTAAAAGTGTATTATTTTTATCATTCCAATC
TCTATTAAATATCTCAAGTAATGATGTTACTAGGTCAGGATCTATAGTATTAAAGCTTAC
AAATCCATGATGTAAATAATGTGTTCCATCAAAATTAGCGGGTGTAATATGAGCAAATTT
ATCATCGATAATCATTAATTTGGTATTATTTTTTTCATCGAATAATTTTATAGTTAAATC
ATTATTGCTACACATCATTTGTAAACTTTTAACAGAGGACATAACATATATATCATTTTT
ATTCCAAGAACCTACCAACATTCTTACTTTTACACCTCGGTTAATTGCAGCATAAATTAT
TTCATTGTATATATTTGGCCAATATGTTGTTTTATTATCTTCTCTAATTATGGGTACTAA
AGATAAGAGTTCTATATCGATACTTTTTTTAGCCTCTGCTAATTTGGTTAAAATAACGTC
CGCATCTAATGTTCTATAAAATCCTAAAATGTTATCCGGGGAATCAGATAAAAATACACC
ACCAATTGGATTATTCATATGATATTTGGTGCCAGCAGGCATGCAACATGCAATTGATAA
CATGTTACATATCGATTTATTTTTGTTAAATGCTTTGAATGTATCCACACGTCTTTGAAG
ATCTATAGCTAATGGTGGAAATGTAGAATATATTCCTAATGTTTTAATGTGAGAAATTGA
TCCACCTGTAAGAGATGCATTCCCAATATAACACCTAGCATTATCAGATACCCAAAAACT
ACCTAATAAGACACCGGGTTCGTTATTTTTCCCTATCTGTACCTTAATATAATCTATATT
ATTTGCTATTAAATCATCCTCATCTTTATTTCCACTTTGATAGTCTACTAAAATTGTGAC
CCTTATTCCGGAAGCAGCAGCATCTTTAAGTTTTTTCAAAATTAATTTCCCATGTTCGCT
GGTGCGAAGATTACAACAAAATGATACTATACTAATATAGCTTTTTGCTTGTGTGATGAT
TTCATCGAAACACTCATGAGTAAGCATATGTTGTGTGTTTATTCCTAACCTTTTAGGAAT
AGTTTCAACAATTTTACATCCTGCACCAGAAGGAGTTTTTGAAAAAAAATAAGACCATAA
GGACCACATTTAAATAATCAAAAAAATAGTTTATTTATCTGTAGAAAGTTGTTGAAGCTC
AGCTTCATCAAAAAGAAGATCGTCCAATAGATACATATTTTCTAATAAATCAATAAGTAC
TTTTATTTCGGATATGATGTTCATCACTGCATCATATTCCATATTTAAAATATCATCTCC
GCATAATAATTTATCGAGTTCGTTACTGATTTTCAAACCCTCTGTATATATGTCAGAAAT
CATTTTTATGATATTTAATGATTACACGATTAAATGGTATCTTTTTTTTCAACTTTTTAA
TAATAACGGCTCATCTTCTTCGCCAATTTCATAAATCTTTTTTTTCTTTTTATGTTGTTT
TTTATTATTTGTATTGTGTATCATTTCTAATATAACAGACCCTATACCAATTATTGTCGA
AAGAGAAGCTATCATCAACATAATGATCTCGAAGGACATGTCTGGAAAAAAATTAATTAC
AGTTATTTTATATATTTACGTTTTAACTTTCTTATTCTATTTCAAAATTAGATGACCAAA
AATATTTTATTCGCAAACCTATAATTATATATATGGATGTATAAATAGTTTGAATGAAAA
TATTTATATTAAGACTATCTTGTCCATCTCCTCTATCTGTTATACAATACTTACATATAT
TTTTATTACGTTTTGCTTTTTCTATACAAGTTAAAATAAATCCAGGTAAAATATATTGGT
GCTGCGATTGTTGAAAATGGAATGGTGAATATAATAATTCTAATAATGTAAATTTATGAC
CGCGAATCATAATAGATTCTGAAGTTTCTATCGAATTTGTTGGGATATATCTAACATTAC
CTATCTTTACAAAACATCGATTTCCTAATAAACAATTATCATCCAAATTTATTTTAATTT
TCTTCATATTTTTAAATGGATTTAAACTAATTATATCTTCCAATTTATTAATATCCATTA
TAGTGGTAAAGGCACAATATTTTGCTAAATAACAGCTTTAAAAATGTATGCTTTTTCATT
TTTAGATGGATATTAATTTAAAATCATTACAAATATTATCTATATATGATTTTTCTAATT
TATTGATATTTCTTATTTTGTTTATAAATGATTTATACCGTTTATTTGAACGATTTCCTT
TTTTCTTATTTTTATTAATTACTCTTTTAAACCACAAAGAATTTAAGTTAATTATATTTA
ATAATTTTTCTACATTTCCAAAATTATTGTTTATAAAATCCGATACCATTTTTTTATCTA
ATGTTTTCATATTTACAATAGTGATCAAATCCATTATTTTTTTTTTATTTAAAATATTTA
TATCCTTATTTAACATTTTAAATGTTGGAGGATATCCATCGAATAACAAATTATCCTTAA
CAAAATATATTTTAAAATCATTAATATTATTAAACTCAATAAACTTATTATAAACTTTTT
CCACCGATATAGATAGTTGTTTAACTTGATAAAATATTAATAAAGATATCTTTTTTTCAT
TTATTATATTTTCCCATCTTGGTAACGATAGTATATTTTCACATATATATCCAAATTCTT
TTAATATAATATAATTGCATATATTTAATGATTTACAATAATCTAAACATATTTTTGTTT
GATATTCTAAAGATATATCAAATAAAGATATTAAACTAGTAATAATTGCTGCAGATTTTT
CCATACTCTTTATTTATTATTTTTTAATAATTTTTTATAGTTTTTCAGTTCTGTTTTTTT
GTATTATAAATGGCTTTATCCAATATCTCTTCTCCATATTATGCACATACACCATTTTAT
ATCGATACAAAAGAGGGAAGATACCTAGTATTAAAGGCATTAAAAGTATGCAATATTAGA
AATGTAGAATGTGATTCCGCTAAAGCATCGTGCATACTTAAAGTAGAAAAGCCAGTTGTG
TCTGCATGCGAAAGACCTCTTTCTCCATGCGAGAGAGCGGCTAGAGCATCATCTCCAAAT
AGAGCTAATAATAACGCTATACCTTTCATGAAAACAAATATGTTAGAAGATATTCAAGCG
AATAATAGAAATGTAGTTTCAAGAATTTTAGGTTAATGAGTAATGATATCTTTCTCTATA
TCAATTATTCCATGTTTACCCGTTTTTTTATCTCTTGGAATAATTTCATATATTGGTTGT
TTGTTTCTACCAATTAGTGAATTGACGATGTCTGTTAATGGTATAGATATATCATATTTC
ATCAGAGCTTGATAGATAAGTATATGAGCGCTTATACCCCTAGAGCTTATTTCATGAATT
TTATCATTTCCACTTAATAAAATAGTATTTGAAAAATATGTATAAAGGGTTTTATCATTT
ACAAGAAATGCAGAATTTGACACATTTTCAAAATCTACAGCATCATCAGCATTAAGACTT
AATATATCACTAGATAAAGAATTCTCATCAAGATAAACATAACATTTATCATAAGCAAAG
TTATAATATTTAGTATCTACAGTTATTATACGTTTTTTAATGTCTATAGTTGATGGCATC
GGCATATTATTTGAATTACCATTTAATATTATTCCATACTTATTTCTTACATATTCCAAT
AATGTTGCAAACCGTATTGTTAATTTATCAGGATTTTTTGCTAAATCTTCTAACCGATCA
ATTTGAGATAACATTTTTAACATGGACAACAATTGTATTGTAGGATCAACTATATATATA
TTATCTATTAAAATTTTTGGTATATGTTGCATAGTTTCTTGTCTAATGTTAAAACTATCT
ATTATATGACTGTCATTTTGATCTTTCAATACCATGTAATTTTTCAAGTATGGAACCTTT
AATAAAATAACATTATATCCTGTAATGAATTTTATTAAAAATGCTAAATCTATCAAAAAT
GTTCGAGAATTAGTTTGGAGAATATCTATATCTCCATATTTTATTTCTGGATTTAACAAA
TGTAATGAATATGATCCGTAACATATACAACTTTTATTGTGACGTCGTAAGTATTCTTCC
ATAAGAGAATTAACATTACATACAAGAGAAGAAACGTTGTGTCTCCCCATTACTTTGTCA
CTTATTGTTGCTATATTCATAGAGTTTAATGCATCATTGGCTATTTTTTGCATCGATGAT
GTATTGTATTGCACATTAGATGAAAAAATATCTGGTCCTTTTGTTGTTAACACACCCAAT
ATATCTGTATATGTGGTTACCAATATCGTTTGTAATTCTATAATTGTATATAATTTCCCT
ATTGAATATGTTTGTTCTTGTTTTGTGAAATAATCAAATACTAATTTTTTTATTTCTGAT
ACACTGGTATCTATGTCGGAAAAAAATTTTTTTTTATTTTTCTTAATCAAGGATATAAAA
ATATCTTTATTAAAAATATTTACTCTATGTATATTTTTATATTGAGATTTTAAAGTATGA
TATTCTGTTAGTGATGGTATACGTCCTAAATACTTTTCCAATATTTCTGATATGTGTCTG
TTCATCCTTCCTTTTGTTTATGTTAAAAAAATATTTAATTATTGTCTAATACTATCGATA
TGCATAATTTTTCACACAAATTTAATGTATTATTTAGACTATTTTTCTTAACAAATACAA
AATCGTTATCGCGTATGTATTCTCTCAACAAATTTAATTCTTTACTAACAGATGCTACGT
CCTCACTAAGTATTTCATTTATTTTCATTCCTGTAAAAAATGTATCCACTAAAGAGGCAA
TATATTCATCCTCTTTACTATCGGAATATTTAAATCCTATTACTATATATATCAAAAGTG
TTTGAATAAGAGAATTTACTACGGCATGGAAATTAGATATAGGTTCTTTTAACGAATATA
AATTGGATACATAATTTCCTAAATACTTGTACTCAACAAAGTCAAATGGATAAGCTTTTA
TAATAGCCCCATGTTCTATTTTTTGCGGAATTTGATAATCTCTACCCTCCAAAATGTCTA
CTATAGGTATCCAGGATGGAAAATATTTGTATGGAACATAAAACAATCCATAAGATGCAC
ATTTTGCTATTGAATACACTTGATTTAAGATATGTTTTTCATCCTTCAAGAAATTATCAT
CTGTATTTATTTGTATATTAATTCCATTACTCGTTTTTATATAACACATATCCTCCAAAA
ATGATAAATCTATTCCTGGAATATTACTATATAATATGGTAGATCTTATATGAAGAGGGT
CTGATAGTTTAATACAATTTTTATCATTTTGTAAATTTTTTTTAGATGGTATAATCAAAT
TTTTACTCGGTATCTTTTTTATATTAATCTTATTTCTGGTACATGATATATAGAATAAAG
AACAAACTTTTTTTGGATAAAACATCGTCGCACCTTTGTTATTTTCCATTAAATCTAGTA
AGTATGTTATGGAACTTGTTGTTAATGGATATTCAAACATTAACTTATTCATTTTTGAAG
CACAAAATCCATACTTTTTTACAAATATATCTAAAAGTTTATGATTTTCGTTATACCAAT
TAGTTGTGAAAGTATAATCTGTAACTAGATCTACATTTTTTTCCGATAAGATATCTATAT
CTATTTCATCTAATAAATCTACAATATCTTCATATTTCATCTCTATACACATCGCCATAA
CTAAAGATGAGTGTATAGGTAATTTCTTAATGGGAACCTTCATGTTTGCCTCACAAATAA
TACGTATACATAATTCTTCTGTTAAAATTTCTTCAGGTATTTTATCTATTATGGATGCCA
ATAGATCCATATGATTTTCTTTAATTAAATAATTTATAATATATGTAATAAATATTTCAT
ATCTATCTATATATTTACAAATAATCATAAGTTGATCTTTATTCAAGTGTTCGAACCGTT
CTAAAAAATTATCATCATATTCATCAAAAAATATTCTTGAATAGATATCTAATTTTTCTT
TCTCTTCTACTAGATATTCTTCTGCATAAAATTTATACTGTTCTATGTTTCCCATGTTTA
TCATGTTTATTATATGAGTTTTAAACTTTTCATGTGTTAAATGTTCATGATTTAATAAAT
CCATAAATGACATGGTATCCTTCATTGTTCTTATGGAGGATAATATATCGATAGCTTCAT
CTACTGATATATCCTTATTTAACAATCCTTCATTTGTTGGTACAATTCCATACTTATACA
TCATATCAAGTAAAAAGGAATCAGTAAATGATTGATGTTTATACATACAATCATACATTT
TATAGTTTTGCATAAATACTTTTTCCACGATAGAGTCTGAAAATATATAGTTTATTTGTT
TAACGCTTTCAATATTAATATTAATTAACATCTCATCTATATCACTGTCATAAAATCTAC
TTCTTAAGCACCTAATATCATCATCAGATATGATCATATACTGGATACACTTTAAAATGA
TATCTTTTGTACATTTTTGTATAATTTCGTTTTTATAAAACGCAATATGATCTTTATAAA
TATCTATATTTTTTTGACTATATATTACCGATATTAAATCTATATATAAAATATTTTTTG
GCTTAAACAAATACAATTTATATGGAATAGATTCAATTATTTCTGAATACCATTTTTTCG
GTAAAGAAGTTGGATGTAATCCAGAAATAATTAACCTCATTGCATCATTTATTCTTAACT
TTTTATACGCTTCAGATAATGTATTGCAATTTTGTTCCAAAAATACTTCTCTTAAAGCCG
AGATATTCAACATTTTGTAATACTGATTGATATATGAACTAGTTTAAATTTGTATTTTTT
AAAAAAACATATATTAATTACTTTAAAATTTTATAATTGAATTATTTATGATAAGATCCA
TCGCCATTTTAGTGGCATTTGTTTTTGCTTCCTTTTTAGTACTTCCAATTGCCGATCTAA
ACTTAACACCGCTAATACATAGCGTAGCCGTAAAAAGTGGTTTATGAATTGGTCCAGAAC
TAATAATATCTATAAACCAATCTCTAGAAGTATATTGACAATATTCATTTAATATAGAAC
ATGGATTTTTATCCTTCCATGCCAATATCTTCTCATAAGGTATTGTATCTCCAAATAATT
CTGGGTTATTTTTATCCATTGTCTCTATATCTAATTCATCCAAATATGTATTAGTTTCAA
CTATGGGAGATATTATATCCTCTTCATTATTTGAACACGGCTTTTTAAACCATCTAGGAG
GATTTGTAGGTAATACATTTAATGAACCTTCATGGTACAATTTATAAAGTTGCCTATTTA
TATGTGATTTTTCGATATTTAATCTTCTGGCTATTTCCAAAGCGGTTATATGTCTTCCAA
GTGGTAAATTAGTTATGATATCATTTACTAATTTAGTTATTTCCATGTCGCTATAATTAC
AACCACGAGAATGTACGGACATTATTAATTTTAAGTATTAATCATAAAATATCACTTTTT
ATTAAATAAATTTAAGATATGTTTTCTCCATTTTCATCTACATTCACATCCTCAGTTTCC
GAACTTTCTGGAGAAGGATCATCATCTCTAACATCTTCCTTTTTTACTATGTTCATAGTT
TTTATGTTAAGATCTCTTTTAGATAAATCCTTAAATTTAGGAGGTCTAAAATGGTTTTTA
CAATCTCTACATGTATGCATTACCAATGGAGGTTCATCCGCCGCACGTGTTTGAATCATC
ATAGGTATTGTATTTTTACTTTTGCAAGTAGGACATGATATATTATGTTTTTTATCAAGA
ACGTTAAAATAATCATCGTTGTTTATATCGGATAAATTATCAATATTGTACGATACTCCT
TTTTTGATACATTTTATGCCGTATAACAAGTATCTAAAGACTTCTTTTTCTATCCCATTT
GTTATTCTAATCATGTTACAGATATCTGCATATTCAACGCTTGTATGTGTTTCGATTAGC
GGTTTGTTTCTATACGACAATTTATTTTTTGTATCCTTTGAATATTCTATTCCAATATTA
TTTTTTGGTTCAAATTTAGTTTCTTCTATATTGGATTTTGTATTAAATATATTTCTTATT
TGAAATTTATTTGCATTTATATTTGCCCAGTTTATAAGATCATTTATTTCATTCGAATCA
TTAATATATTTTTTTATAATATTTTCAATATCTTTGTTTGATATCATATTAGTATAAGAG
CATTCATTAGGAATTAAATTTTCCATTTATATTATCTAATAATTATTTATTAAGTATTTT
TTACAAAAATGAATTTAAAGTTTTCATTTTTTTAAAGCTTTCCTTTATGTCAAAAGGAAA
GTAAATTTACAAAATGGAAGACGTTGAAATAAACTCAAATGAAAAGATTACAGCATATGT
ATGCAGACTGTTTAAAGAGTTTTATATAAAAAAATATAATTATAAAAAATTAGATTTATG
TATTAGTAATATAAGGAAAAAAGTATCAAAATTCTATCCCATGATTAACGATGATATCAT
TTGGAATAAAGAATTTATGCCATTATTATACGAATTTATTGCTTATAAAAAAAATTCTAG
CGATCAAAATTTTGAATTCTCAAGTGTTTTAAATTTAACAAAAAACTCAAACTCATATGA
GGATAATAAAAAATATAAAAAGCCTAATAAATATCGTCTAAAATCAAAATACATGAAAAT
GAGGATGATGAATGATACTATTAGTTTTGAAAAAAAATTAAATATGGAAATTAAAAAACA
AAAGGTACGAAAATTAAAAATGTTGCATCAACATTACGAATATATTAATATCAAAAAATG
TTATATTAAATTTAAAAATATTTTAAAGCATGAAACTGTAAGGAATCTAATTAACAATGA
TAGCGGCTTCTATAATAAGTTAATAAAGATTGATTATCATCTATCAAAAATATGTAAAAT
ATCTGCCAATCCTTATTCTATGGTTGAAGCTCTTATGAATTATATGTTTCCAGATTTATT
TGAAAAGGATAATAGGTATACATTTTATAGATGTAATGAATCTAAAAAATATTGTCAACT
GTCTTCAAAAAAAATTAATTTAATGAAAATATTATTAGAAAATAGATTTAAAATTAATGA
AGATACTTGGCAAGATTTGAAAAAATTCATAGATGAGAAAATTTGTGGAAATGCTTCATC
GAATATCATATTGGGAAATTATCCATATTTGAGATTAAAAAATATGTCTTATATTATTAA
CATTTTAACAGATGATAATAATGATGATTTATTCTTACTTAAAAGTATAAAATCAAGTTT
TTCATTAGTAGATTTGACTGAAAAAATTATCAAAAAAAAATTTGATTACATATTTAAAAA
TAGAATGAATGAAAAATATAGATTTTATTTTGATGGAAATCATATTGGTTTAAATCAAAT
AAAAATAATGCAAATATATAATAAAATAAAATTGTTTGTAGATCATAATGATGATGAATT
GGTATTTAATTCATTCGTATATTCTGTGGATATGTGTTTATCAACGCCTAGAAAAATATT
GGGATATAACTTGGAATATTGTCTTAACATCGCAGCAAAAATTACCAACGCTCTTTAGAT
AAAAAATAAAAGCATAATTAAATTACAAATAAATGGATTATATACGCAGAAAATATCTTA
TATATACAATAGAAAATAAAATTGACTTTATAAGGGATGAGGTATTATCAAAGATATCTA
ATTTTACGCTCAATCATGTATTAGCGCTTAAATATTTAATACTTAATTTTTCTAAAGATG
TTTTAACTAAAGATGTTTTATCAAATCCAAATTTTTATGTGTTTTTACACATGGTTAAGT
GTCCAGATGTATACAAAATAGTAATTAAACAATCCTTCGACGTGCCGACGTTATATATAA
AAGCATTAATTAAAAACTATTCATCATTTAACCATATTATAGAAACATATAAAAAGAATG
TTCAAGAATTATTTTTTGATGAAAAATTTATAGAAATTTCAAAACATTCTCATAACTTCG
ATAATATAATTGGTGTTAATTATGATTTACGGTTAAATCCTTTATTTTTTCAAGGAGAAC
CGATAAAAAATATGGAACTTATTTATAGTAAACTTTTTAAAAAATCAAATTTTTTGCGTG
TAAAGAAGATGGAAGTTATAAGATTAATGATTTGGGCATATCTTAGCAAAGAGGATACGG
GCATAGATTTCATGGATAATGATAATCAAGATATATATACGTTGTATCAGAAATCAAATG
GTATAATAAACAGTGACATGACGGAAAAATTTAAGGAATATATCTTTGAAAAAAATAAAA
CTAGTTATTGGATATGGTTAAACGAACCAATATCAGATGATAAAAATATATACCTTGAAG
GAATTGCTGAATCGATGTATGATAAGATTCTAAGCTATATTTATTCAGAAATCAAACAAG
GAAAAATCAATAAAAATATGTTAAAATTAACTTATATGTTTGAAACGGATGAATATATAC
AATCAATATTGTTACAAATAATATATGGAGTTCCCGGGGACATATTATCTATTATCGATT
CTAAAGATGAAACATGGAAAAAATATTTTATAGGCTTTTACAAAGAAAATTTTATCGACG
GTAATACTTTTATTAGTAGTAAAACATTCAGCGATGATCTATTTAAAGTTGTGGCAAAAA
TAAATCCTGAATATTTTGACCCCAATAAGATAATATCTATTTTTGATCATAAACCCGAGA
AAGTAAAGTTTTTTGATTCATTAGATATTAATAAAACATATATATCTAATATTATTTACG
AAACAAACGACTTAAATTTAGAAATAATGGAAGAATTACAAACATGTCAAATATATAATG
ACGAAACAAAATATTTTATAAAAGAATATAATACATATTTATATTTAACCGAAAATGATC
CGTTTGTATTATATAATGGTATATTAGTCAAGCTATCAACAGTTCCTATAGACAAAAAGT
TTTCACTATTTAGTGAAAATATTTTAAAATATTATCTAGATGGAAAATTAGCAAATATAG
GACTGATTATACCAAATTATAATGGAGATATTATTTTACATATTTTATCCCATTTAAAAT
GTGTTGAAGATGTTACAACCTTTATAAGATTTTCTATCTGTATAAACTCTAGTATTTTAC
CCTCTATTATAAGAACCATCTTGGCAAATTTTAATATTTCTATAATTATATTATTTCAAA
AATTTTTACGCGATAATCTATTCTATGTTGAAATTTTTTTAGAAAAAACAAATCACTTAA
CTAAAAATGATAAAAAATATTTATTAGATGTTATAAAAAATGGAAGATCTTAATTAAGCT
ATTCAGCGTATAATAAATATGAATGTTGAAGACATATACGCAGAATCCCAAAAAAGAAAT
AATGACCAACAGACATTTTTTACAAGAAATTTAAGTCCACTAATGAAAAATACATATCTA
TATCATAACTATTCCTATGGATGGATACCTGAAACGTCCATATGGAGTAGCAGATTTGCT
AACTTAGACGTTACCGACTATTATCCAATAACAATAAATTTATTAAAAAAATTTGAATTT
ATGATGGCTTTATACAAAGGACCTATACTTCCGTATGAAGAAAAGATAAATACAGAATTT
ATTTCAAAAGGATCCTTTTATGGAAGATATATAAATTTTTTGAGAAACTTTTCTATATTA
CCGACTAATGAATTCATTTCATTTTTATTATTGACGTCAATACCAATTTACAATATTTTA
TTTTGGTTTAAATCAACTCAGTTTGATATTAAAAAACACACATTATTTAGCGAAGTCTAT
TCCAATAATGATAGACATATAGAATTGGCAAAATATTTTAGGCAATCCGGTGATTATAAG
CCTCTTTTCAGCAGGCTAAAAGAAGATAATATTTATACACAACCATTTCCATTAAACACA
AGTAGAATTTTACATCAGAATTTACCAAATTCTTCTACTATTTCTGATTATGAAACATTA
TCCAATTTAAGCGCAATCTTATACCTTACAAATTATGATCCTGTATTGATGTTTTTGGCA
TTTTATGTACCTAATATTTCCGTAACAACCAAGATAACTCCGGGAGTAGAGTATTTAATG
AAAAAGCTTAATATGGATAAAAAAGATATTACATTAATTTAGTTAATTATAAAATATTGG
TTTTGTTCCAAACATTTTTTCAAAAAATGATGTGGATAAAACTTTGTTATCTAATAAATT
TACTATTTCGGTGGCTAATCGTTTAAAATATACTTCGTAAAATATTCTTTCACATGATTT
TAATTTAAAACCTCTATCTACTATTCTTTCATATGTTTTTATATTTACTAATTTTTTCTG
CCAAGGGTCATCATCATTACATATATATGCAAAATAATATCTTTCTCCTATTTCTATATT
TTCTAAATTATTTTTATTATATTCATTAACTAATGACATATTTGGGTTATCAATAGCTTT
ATAATTACAATGATGTGTTCTACTTAATAGAAACATTTCCAACGGAGCTGATCTTTTATC
AAATTCTATTCGTAAATCATTTTCTAGTGATGTTAAAATATCTATACACACTTGAAGAGA
CGTCATAGATCCTTCCGACAACATTTGTAATATTCTTGTTTTATATATCTTTATCATGTA
CTTATGAAATCTGGCCACATCTCTTCTTGTTTCACTAGTACCTTTATTAATTCTTTCAGG
AACATAATTATCTCCATTACACGTTGGCAAAAATTTAAGCGTCGTATACTTTTTTTTAGA
TTGCATAATAAGATTTTTATAAACAGCTTCAAATTCTATTTTAAAATTTGCAAATAAAAC
TTTTCCATTTATTATTTTTTCCAATTCATTAGCAACAATTATTGATGTTTTTACATCCTT
TGTATTCATCTCTAAAAATATGGAATCTGTATCTCCATATACGCTTCTAAAATCAAAATT
ATAAACCTTTGATAAAGATGTATCGATACATATATCATTGGATTCTTTATCATCTTTGAA
GAATGGATTAATAGGATAAGCGGCTAATTGTAACTTTCCAGATATTAATTTAGATCCGTT
TAATACGGAATTTAAATAATGTATCATTTGTCTTCCAATGGCTGTACAGCTTTTTGCAGA
GGCATACGAATATAAAACACTATTTCTAAATCCCATTAACCCATAAACAGAATTTGCTAT
AATTTTGTATGTATATTGCATGGAATCATAAATAGATTTTTCTGTTGAATCAGTTGCCTT
TTTTAACAACTTTTTATATTTAGCTCTTTCATCTAAAAAAGTTTTTAATAAGTTAGGTAT
TATACCTTCCACTGTTCGTTCAAATACCGCAATTTCAGAAATAAGATCTGAAGATCTTGG
TTCGCAATGAACAGCTATATATTTTGGAGATGGGTATCTTTTCTCTATTTCTTGTTTATT
TATTTCGGCCTCCAATCTATTGTTTGCAACAAACACACATACTAATGTTTCTGGAGATAG
ATTTCCAAATAAACATACATTAGGATATAAACTATTATAATCAAATATCAATACATTATT
TATAAACATTTTTTGTTTAGGCGCAAAGACTTTACCACCCTCGTATGGAAATTTATTCTT
TTTTTCATTTCTTGATAATATCAATTTCTTTTTTAGTAATAAGTTTAATAGCGGACCTTT
TATTAGTGTACTAGCTCTATATTCAAAAACCATCGATTGGGGTAAAATATATGTGAATGC
TGCAGCATCTATTTTTGTCTCAATACCATAATAATTCCATAAATATTTGCATAAACAAGC
GTCGTGCATACAATAATTTCCCATTTCTATAGCGATATCAAGGTTATAGTTTTTATACAT
TTCTGATAGATCTACATCATCTTTTCCAAAACTTAAGATGTATTTTTCTCCTTTTGTAAA
CGAATTGTTTTTATCTAAAATCTTTAATTCAAAACTTTCACTTTCATAATTGATTTTTTT
CTCCAAAATTTTGTAAATATCATCTCCTATTGTTATATAATTTCCTGTACTTAACACTTC
TGAAAATATTTCCGATTTTCCTTTTGTATCTGTTGTAGAATTTCCAATAAATGTACATAC
GTTATTATCTGTTTCTATCAACTCAGTCACGCAATTAAATACATTTTTTGATATAGAATC
TAATTTATAAGAATCCAATTTTTCAGATTTTTGTATATATGTATACAAATCAAAAAATGT
TGTTCCATTATTGTTATTTATATGGTATGTTGTATTTGCCACACCACCAACACCTTTGTG
ACTTGATAAGTTTCTCTCATAGATACATAAATGAACTACTTCCTGACGGTCAGGAGATTT
AAAAAGGATTCTTTCTCCAGTTAATAATTCTAATCTATTGGATATATATCTTAAATCAAA
GTTATTTCCGTTAAATGTAATTATAAAATCAAAAGATAATTCCAATAATTTTTTTGCTAT
CTTTAAAAGTATAATTTCTGAACATAATATTAATTCTTTCTTATAATCCATTTCTGATAT
AGAGCTTATATGAAAAAATCCTTTTTTGACAGAATTATTTATTTCGTCTTCGGATAACAT
CTCCTCATTAACTAATGTAAATCTAAATTCCTTGTTTGACAAATCTATATAACAACAACT
AATATGTGAAACAGGATTTATAAATACAGAAGGAAACTTTTTATCAAAATGACATTCTAT
ATCTAGAAATAAATACGATCTATTAATATTAAATCTATCTATAGGAGTAAAACATTCTTT
TGGATCGTTACAATGATAACATTGGTTATTAATTTTCTCCATTTTTTCTAAGTCAATAGT
ATAACAACCTTCCGGTGAAATTTTGTTTGAAATAAAGAACCAAGTTATATTTAAAAATTC
ATCCATAATAACTTTAGAAATAGACTGTTTCTTTATTTCTTTTATTAGCCATACATTCAC
AGTTTCTCTTTTTCTATTAATATCTGTTACATAATTGCTTGTATATTCGCTTATATCAAT
CATATCCATGGAACCAAGAAATTCTGAACCATAAATTGATGGTTTTAAACTCTTATATAC
ATCGTCCGTAACTACATAATAGAAGTAATAGGGAAATCTAATAAATATAGTTTCTAAATC
CTTATTTCTAGCTTTTAGGAATAAAAATCTTTTTTCCCCTCTGCTTTCAAACCAATTTAT
ACACTTTATTTCCATTTTTTTAAATAAAATAAATTATATTTTCATTTAAATTATGAAGCC
AAAATATTGGGGAAGAGCTATTTGGAGCGTTATTTTTATTATTATATCACAAACAAAAAA
TACCGGAGATATAGAATCATGTAAGAGAAAACTCTATACCATTATCGATACATTACCTTG
TCCCACGTGTAGAATTCACGCTAAAGAGGAAATACAAAAACACAATATAATGTCGACTAA
TGATTTAAACTATATTTATTATTTCTTTATAAGTTTATTCAATAACTTGGCAAATGATCC
AAAATATAAAATAAATTTAAGAAAAGTTAAACCGCTTTAAACATATTTTGTTAAATGTAT
CCTGAATATAATGTTTTCATCAAATACAAAAAACTCATTATTTTCAACCTGGGAAATATA
TCCTTCAAATAAAACACTAATTCTTATAATATTCTCCTATTAATCGTATAATCCTTTTTA
TTATTTTATTTATGGATATTATATTTTATATTGATCATTTCCATCTATACCTTATAGATT
TAATTTTTCCATTATCGAAGATTAAAAATACATTAATCAGTTCCATTTAGATCCTCAAAT
ATAATTAATATTACTTTTAAAAATAAATGAATAAGATGTACAGGTAACGATCCTTTTACG
ATAAGTTCATCTATCTCAATATCAATATTTTCATTTACCCTTAATTGACAAAAGTATATT
CCGCATCCTTCAAATACTGAATTTATTATTTTTGAGATAAATTCTCTATTGTTTCTAAAT
CGTTGTATAATTACTATTCTATATAACAATATGCTAAACATATATTCTATAATTATATTT
AATAATAAAACTACCTTCGCATATGATTCGTTTAATGGAAAACATATAGTTGATGTAAGA
TTATTTACAGATGTAGATACGATAGGAATCAATTTATTTACTAAATTATTTCCTGATAAT
ATAATATCTCCCATAAATAAGAAGTTTTCCGATTCTGTGATATCAGAAATATTCAACTTT
ATCTTCATCACATCATCCGATAACAATGATATAAGGGGACCCCATCCTCTTTTCCCGATT
ATATTTGGGTTAACCATTCCATGAATAGCGTACCTTACCAAATCATATAAACATTTTATT
AAATCATCGTCATTGGATCTCTCATGTATTGTAACATCGTTACTTTTGATTATATTATAA
GATGCTGTAGAACATTTTAAACAATTACACAACGGCATCTTTGCCATTTTCTCAAAATTT
TTAAGTTTGTAAAATATATTAGCATGATTATTTAATATTTTAGTAGAGATAGAATCTAAC
ATATCCATAATAATAACCGTTTTATTCATTTTCTGATATGTAGTTGTATATGTTAATGTT
TGAGATTTCCATTGCTTGATTGCCTTTAGAGCAGCTATCTTTGTTTTTGTACTTACATTT
GATAATAACACATTTCTTACAGAACATGGGTTAAGTCTAAAGTTTGCTAAAATATTTTTA
ATTTCAGACAATGATAATTTTGTTTTGGCTAATGCATTATCTATATGAATAAGTATTCCT
TCTATACCGTTTTCTTCATTTACTTTTAAATGCCTTACAGGTTTTTTTAAAATACACGAT
TTTTTAATTATATTTTCTGGATTAACAGTAATAACTCTGGATTCAGTTTTCATAATATGG
TCTCTAAAAACAGTTGCAAACTCTTTACAACGTAAATCATATAAGGATATATTAATTTCT
ATAAACTTCTTATCTTCATCACTAATATATTTTATATCCGTCATAACATCTAACGAAAAC
ATAGCTATACATTTTATTCCATACATACTCACTAAAACTGATTTCGGAACAGAAAGATAT
AGGAATCTATTAAGTCCACTTAGAAGCATAGGCAAATTTTCTTTGACTATTTCATGAATT
TTTTCAATAAAACATTTATTATTTTTGATATTTTTAGATATGTAATTAATAATATTCTTT
TCTGGATATTTTTTTATTAATTCAATAGCTTTTACACAATCGTTTAATTTCAATAATGAT
TCATTGGTAGGGGCTATATTAAATGTATCTGATAGATAAAGAAGTGTTTTTAAATCTATA
GATAAATTATCATATAAATATGGAATAGAATACGACGGGACTGATTTTATCAATTCTATA
ATATCTTCTTTAGATAGAATCATATTTGTTGACGCTATCATGGGATCTATTTTTAGAATT
TGAGTAGCTGTTAAAATTTTTTTTGATATGATGAAATTTATATCATCTCTCGTCAGTAAA
TTATTATAAATCATTAATTTAATAAACTTTATTCCATGATTTATTAATGTTTTTCTATGC
TTTAACACATGATTATATAATTTTGTATCAATAGATGATGTTTTGTCAATTAGCTCTATT
AAATCCTCCACTTTAACTGAATCTGAAGGCATAAATCTTATATTAGCAATATCAAATTCT
ATTGCTTTATCATAAAATTTAGATGGCAAATTGCCGTGTAAACCATATTTAATAATAACA
TCAAAACAAGATTTTGGTATTTTATCAAAATCAAGCTTATTTGATATTATCTTTGAGATA
GCATTTCTAGCTTTTCTAGAATACATGTACATTTTTATATTTAATTAAATACCCTATGTT
GTTTTTCAATATTATTTTTATCCTTCTTAAAAAAAATATACGGATATAGAAATGTATATG
ATAACCATATACAGAAACAGAATGCTATAAAAACCATAACAATTACTATCATATTTATAT
ACTATATTTATTCGATATTAGAGTCCATAATAATATTAGGCACTATTAAACATTCAACTA
CTTTAGATACATTAACTTTTTCATTGTCCTTTACAAATTCTGCAATACTGTTATAGAAAT
CATCTTGAAATTTTTTTGAATATCTATCAACATGTGAAGATATAGAATTTATTAACATAC
TATGTTTAGTATAAATAAACGATCCAATTTTTACGGTTTCTATACCCAAAATGTTTGCAA
TTTTAATATCTTTTAATATTACATATATTTTAGGATCTTCATATTTTGTTATTCTAGTAA
AATAATCATATAATCTAGTTCTGGATATTGTATTATCCTTTACTTGAGGACATCTAAATA
ATCTTGTTTTGAATACTTCTAATAATTCGTTTGGGATATAATAAACACTATCCTTTACAG
AAAATCTCTCATCCAATATAATATCATTATTTTTAGCTAGCTGATTAATCAAATCTTCTA
TTTTATCTACTTCTAAACTATATAAATTATTATTAAATGTAAAGGTATTGGCACTATTTT
TTAGTCGCATGGATAAAATTTTTACATCACTAATATCTATATATAAAGGAGAACATTTTG
GAATTTTTTCGAGTATCTTTTTCTCTATATCAGTTAAGACCAAATCATTTTTTGCATCAT
CGTTTAACTTTCCATCTTTAGAAAAATAATTATTTTCAACTAAGCTATTTATAAGAACCG
TTAATACCCCATTGTTATAATTATCTAACTTAAATTTTTTTACAAAATCTTTTTTAATTA
AATCTATTGGAATTTTAGATTCCAATTTTTTTGTTTGTGACTTTTTCTTTTGTGGATATT
TTCTAGCAACTAATTCATCCACCATATCATTTATCTTAGATGTAAAATATGCTTTAAGAG
CTCTGGCACTTATGCTATTTAAAACAAGCTGATCATCATTTTCTTCCATTTAAGTTTCTT
GTATATCCTTTAAATACAAAAAATGAAAAAAGTGACACGATTATTAATGAAAATATTAAA
AATAAAAAATTTTGACTGTTAAACCATGATACAGATTTAGTTGTTTTTTTCGAACCATCT
TCATCGCTTAATACAGATTTAACAACATCAATGAAATTATTAAAGTCATCATCCGTGGAA
GACATAAATACACCAAATATAGCAGCGTATAGTTTATCCATTTATACATTAAATAATGAT
GAATCTGTTTCGTCTTCTTCTATGCATTCATCGTTAACTATATCCACTAATCCAAGTCCT
CTCGCTATATCCTCCTCACACGTTTCTGCCATAGAAACTTTTTCACTTTTTCCATCTATA
TCTATCACAGTCGCACTAAAATCTCTAGCTATTATTATTTTTTTTAATGCAAATGTAACT
TTTACACTGTTACCACTTCTATAGAAAACTATAGGAGCAACGATTATTTTTGATATCTGT
TTATCCCTTTTAGATAAGTTCTCCAATTCTTCAGTAACGGATTGTACAATAGATTTTCCT
CCGGGTACTTTATATTCAACAAGAGCACCATTCATCTTATTGATATATAAACTACCCTTG
TTAAGTGTTTTTTCTTCCAAATCCTGTATAGATGATATGTTGCTTAAGGAAGCCGGTATT
TTTTTACCATCTCTTATATTACCATAAATACACTCCAGCAACTGATACATGATAGGACTT
GCTGCCGTAAGACGTATTTTCAAAAAATATGGATCCATCGATCGACAATCACTTTTTTTA
TTTTTATATATTTTGGATTCTCCTTCCAAAGAAATATAAGTGGATGTTAATTTTGATGCA
AGAGACTCAACGAGATTTATCGTTATAGAAGAACATGAAGGATATTGCGAAGCGGATAGC
ATAACATTTTCTATGCATTTTTCTGTACTTTTACTAATGGATTTCATAAACTCTATTATA
CCATTACACGTATTTAAATTACTTTCTTCATTGTTTGTAGTTTCTTTTTTTACAGGTTTT
TGAGCTACTGCTTTACGCATTTTTATTGATAAAATCTTAAATGACAAGAATAATCTTTCA
GTTTTATTTATATAAAATATTATAAACTTTCAATTGTTATTATTAATCTTCTTCGAAATA
AAAATAAATATTATTTTTATCATCATCATTATCATCTTTATCACCTTTATAAGTGAGTCC
TACGGGTTCAATACCATCGCCGGAGGAAGTGCATAAAAACCAGCCAGGAAAGGCAACAGA
TTCAAAAGTGCTGGTAAGACCATTATCCGATCGAATAAACGCAAATCTTTTGTCTTGATT
TTCGTCCAATGAATTTGTTTTTTTATCACTTAAAGATAAAGTGACTTTATCCCCATGTTT
TGTACATTCTAAACTCTTTTCCCCATTTTTTACGCCCAAGAACATACTATTTCCGTCATT
GAGTTTAACCGTGATCTTCTCTGCTAATGAATTGTCTTGTATATTTCCAGCAACAAGTTG
ATTATTACGTAAATAAAAGATTTTTTGATTCACATCCCAAATACTATACATAAACATACC
GGCGGCTTTTGAGTTAAATATATTAATGTATAAAACCAGCAATAAAATAAGTTTTTTCAT
ATAATCTCTATATTTATAACTATTAAAAATATAAGTTTATGAAAATAGCTTCTTAATATA
CGCCGAATATAGTGCAATTGTTCCAGGTATAAATATCAATATTGCCAAATACTCTAATAT
ACTAATAACTCTATTAAATGTTGCGGAGCGCATAGAAACTATTCTATGTGGCGCCAATGA
TTTAAACGCTAAAGCTCCTCCAGAAATTATCATTAATAACGCTAAAAGTGTTAAACTGAT
AGCTGAAAAGATTTCTTTTGCAGATAAAGCCATTTATAATATAAATAAAATTATTAAAGT
ATATATAATCCTGTCCTAGTTGTAAATGTTGAATTATCATATATATTTTTTTTAAAATAT
CTTTTTCCTTTTGTTGATACGTTTAGTTTAGGAAATGTAAATGTTGCCTCTAATATCCTA
TATGTATAATATCCCTTCCAAATAAGATTTTCTTTTTTAAATGTTCCTGAAAAAGTAACA
TTTTTTACAAAATCATCTTTAGCTATAATTAAAATCATAGATAATCGTTTATTATCTATA
TGCGTTATAAAATCAATTCCATTTTTTGTAATACATTTTATTTCCACATATGAAGGCAAT
TCAATTAACGATACAATCTTTTTAGGAATATACGGTATTAAATTTATTGATTTTTGCGGT
AATGACGATACACCACCATCTGAAAATTTTGTTTTATCAAATATTGATATAAATTCACAG
ATTGAAAAAATTTTTTTTTCTGGAAATTTTTTTGAAGAACTTAGGGAATCAAATAATCTT
ACCGAAGTTAATCGTGTTATATCATCCGTTAATATGTTAATTTCGTTTACAAAAGGTTTT
AATAAATCTATAATGATATAAATATTATCGGACAATACATAAGATATACCGCAATACGAA
TCATTATACGTTCCAAAAAATAATACGATTAAAACACTTTCGGTATCGAAGGGAAAGAAA
GATATAACGGCGGTAGGTAAAATTTCAGGAGTATCGAAACAATTTATAGTCAATTCCTTA
TCTGTTTGTATTATCACTAAATCCTTTATACTATGATATGATAAAAATTCTTTAATTTTG
TTTCTAATGTGTAATATAGATCCAGTAAATATTGTTCTAATTATAACATGATGCTCAGAT
TTAATTTTACCAGATTCTTCCACGCCTGTCATCCACCCGACTGGTAAGAAAAATAAATCT
GTAATATGAGAATATTTTTTTATAATTTTTACCAATCCTGTAATTACATATTTTTCATAT
TTAAAACATTCGATAATTGCCCATGACTTTAATACATCTTCCAACGTATTATATTGTTTG
TTGAAAATATTCTCATTACAATAATAAAAGTTGTCAAAATTAAATGATATTGTACACTCT
TTCAAAATAATAGTTTCAGTTTTAATTAATTGTTTAGTTGGTTTATTCATTCTTGAAGCT
GCTTGCTTTATAAAATTATTCATTTTTATAGTTGATAATTTTATTTGCCTTTAAAACTAT
TTTGTTATACAATGTAGTTATTGCCTTTTTTGTCCACGCTTCCATTTTTTGATATTCTTT
TAATGCATCACATTCCAGTTTTTCAGTTTCTATTTTCATATCTCCTATATTAAACAAAAT
ACTTTTAAACAATGTCATTTTTTTATCAGCTAAAAACTTAAAAAATGTATATATTTTTCT
TATAGACTTAAACCCTTTGGGTGGAGTTTGTGTACATATAATCATAAATATACTAATAAA
CATACCACATTCTGATTCTAATAACTGGTTCACTTCAACATTGATAAATCCAGCCTTTAC
ACCGAAAGAATATTCAAAAAATCTAAATAAGGTATCGATGTCACAATTGCTATTTTCTAA
TATTGAAGTATGTTCATTATTTTTATTAAATCCGTCTGAAAAAGAATAAAAATAAAAATT
TGGATAATGATGAAATTCTTCCGGTATATTCCCTCCAGAATCATAAAATATTACAAAAAG
TTTTTCTTTATCAAAAATTACACATTTCCAATGTGATAAGTAACAAAAACCAAACATAAC
ATATCTATTTGCAGATCTTCTTATTTTGTCCCTAATAATATATGATAAAATATGTTTATT
TAAAAACACATCAAATTTTTCATGAATAGGTACATTGTTTAAAAATCTCATATCATATTG
TCCAATATATTCAACTTCTGAACCATATGAAAATTGTGATACTAAATTATGAATACTTTT
ATTACTCATCCAAGCTTTTCTATCGGGCTCGATTTTTATTTTTACTATTTTATTATTTTC
TCCAGTAAAAATTCCTTTTTTTGACAAATCATCGATGCGTAAATCCATTTGTGAAAAATC
AATAGCTTTAGAAATCTTTTCTCTTAATTTTGGTTTAAAAAAATATTCAATTGGTATAGA
TGTTTGAAATTGAAATATCTCTTCTATCGAATAGTTTTCTTTTAATTGGTTAACCAAATT
AATTTTTAATTGTATATCATCTTCTTCCGAAATATCTGTTATATTTTTATTCTGTGGAAG
AGAAAGGTATTTTAATTTTGTCAACTCCAATAAAATTGATAAGGGTATACACGATACTTT
TCCTGCAGTTTTTGATTTATCATATTTTTCTATCACATATCCATTACAATTTGTTAAAAA
TTTTGATATATCCAAATTAAAACAAAGACCTGACTCAGAATATATATAAGATAATAAATT
TGTAAACCCTAATTCAGGAATTTTATTTATAACTAAATCTGTATATCTATCCATTTATTA
TGTTGAATCCTCTACCTAATATATTTTATTTTCCAAACTGTGTGAATATATTTTCATATC
ATTATTCACAGGTAGAATTTGATTCAATGAATATTACGGATAAAAAAAGATTTTCGATGG
CCGTATATCCTCTCATAAAACATAGATGGAAAAATTGTTCCATAATATACAACAATAGAA
CATATAAACTAACATGTGAGAATAAACAATACAATAATATAGAAAATAAAAATGTTAATC
ATCTAGATATAAATATTCCGTCAAAAATTAATATTAAAAAAAAGGAGTATACGATAGGAA
ATATAAAAATGAGTTTCGAATGTTATAGTTATATAAAATCATTTTCTATAACAGATATAA
CTTTATTTGACGAATATATACTTCGTGGATTATTAGAGGGAGGTAATAAATTAAATATAT
TTTCGAATATAATGGGAAATCAAAATGATACTATAAATATTTTTGGAAATCCAAAACCAT
TTTCTAAAATACCTCTTAAATCGTTGCAACCAGATATACAAAATCAAATTTTCGAATCTT
GGATTTCTAATAAACCGGTAATATTGACGGGAGGCACAGGGGTGGGAAAAACATCACAAG
TTCCAAAATTGTTATTATGGTTTAATTATTTATTTGGAGGATTTGATAATTTAAATATCC
TGAATAGAAATTATATTCAACGACCCATTGTTTTATCACTTCCCAGAGTAGCTTTAGTAA
AATTGCATAGTAAAACTTTATTAAAGTCATTAGGTTTTGATCAAATAATTGGATCTCCAA
TAACATTAAAATTTGGAGGTATAGAAGATGAATATATAAATACTAGTCCCAAAAAATATG
GACTTGTGTTATCAACTCATAAAATTACATTATCTAGACTATTCGAGTACGATACAATAA
TAATAGATGAAGTTCATGAACACGATCAATTTGGAGATATAATCATAGCTATTGCAAAAA
AATATTTAGATAAGATAAATTCTTTATTCTTAATGACGGCCACGTTAGAAGATGATAGAG
ATAGAATAACTGAATTTTTTAAAGATCCTATATTTTTACATATACCGGGAAATACACTTT
TTAATATCTCCGAGGTTTATATAAAAAATAGATATAGTCCTAATGATAAAATAAGATATA
TAGAAGAAGAAAAAAAGAATATACTACATGCAATTAATAAGTATACACCACCTAAAAAAT
CATCCGGAATAATATTTGTAGCCTCTATATCACAATGCGAATCTTATAAAAAGTATTTGT
CGGAATATTTAAATTTTAATATTTATATAATTCATGGAAAAGTAAAGAATGTGGAAGAAA
TATTAAATTCTGTATACAATGATATAGATACAACAATTATTATATCGACACCATATTTGG
AATCAAGTGTGACTATAAACAATGTTACTCATATTTATGATACCGGTAGAGTATTTTTAC
CTTCGCCATACGGTGGAAAAGAAATATTTATCTCAAAAGCTATGAGAGAACAACGAAAAG
GAAGAGTGGGTCGCGTAAGTCCCGGAACCTACATATACTTTTTTGAGAACGATTATATAA
ATGTAATAAAAAGAATAGATTATGAATTTTTACATAATTATGTATTATACGGAAATCAAT
TTGATTTAACATTGCCAGAAGATTTGTTTATAATACCGACTGATATAAACATGCTAAATA
AAGTAATAAATTATATTGATTCGTTTAACATAAGCAAAAAGAGATGGTATGAAATATTAT
CTTCCTACTACGTCAATGTATTAGAATATGCTAAGATATACGCCTTAGGGGGGTCAGGTG
CTAATGCATTAGATAATTTTGAGAGAAACAACGTATTAAGTTATGAAGCCATCGATGTAA
TTAAATCACTAAATATGAGGGCAAAAATATTACATAATAGAAAATATAGGGGAATTAAAA
ACATGTATATAATTACGTGCAAATTAATGTTTGGTGTTTATATGGGAAAAATATTTAACG
TTGTTCATAATAAACCATTAAGTGGATATATAATAATGATATCCGATTATGAATTTTTAC
CAGATTACTAATTAATTTTTATTATGATATCCTTTTTCAATGAAGAAAAATCCTCTATAT
CACTTTTATTTGAAACGACTATGCAATGGCGATTAAACATCTTATTGGATGTTATTATTT
TAAATACATCCTCTGGATAGATAGTAAACATAAAAATATAAAATATCTTTTTATCTAGTT
TAGTAAATTCAAGAGAATATATTAGACCTTTTTTCTTTAAAGACCACATTAAATTGGTCA
ATGTTTCGTTAGAAATACTACTTCCCTTTACTATGCCGCACACAAAACTTGAATTGGTTT
TTATATCATATCTAAGCTGTTTACCAAATAATATTTTATTTTTATAATCTTTACAAAAAT
TAATAGTAGATTCTCTTTTAGATAGTATATCTTCTATAGAGTTTCCGCTTACGAAGAATG
ATAATATTAAATATTGATAGATGGCAGCGGGTTTAGATTTACTATATTTTAAAAATGTAT
CAGATTCTAAAATTGTATTTATATCATCGGATGAAAATTGATGATGAATATTTATTCCGT
GATTACTTTTAAATATTTTATTATTTTTATACATAATACCTAATATAGCATAATCTATAA
ATGCTTTATCTCCATATTTTATATGAATTTCATTATTAATCATTTGTTTTTTCATTAGAT
ATATGTTGTTATTAATGATATTTGAACTATCTTTATTTTCATGATCTATTTTACAATCTA
AAACAACTATCTTATGTTTTTGTCTATCTGTTTTATTAAATATAGATTTACTAAAATTAG
GATAGATAGATATATATTTTCCATATCTTATAGAGGTATAAATTTCATCTTCCAAAGATT
TAAACATATTTAACATATTATTATTTACATCGACTATATAATCGAATATATCATTTTTTA
TCCATGGAAAACATAGATACAAATTCATGAGAAAATCATCTGAATGATTAAATTTAATTT
CATCTGGAATAAATTTTAACATCGATACCCCCTTTAGAAAATTATCATATTCATGTTCTT
TTACAAATGAAATTGTTATATAAAGTTGATCTCCTACCGTCTCATAATCTATTAAATGAT
AAATTTCATACAAGCACATTATCGCTAATATGTTTTCAAGAGATTGTTTTACATTAACCA
TAACGGTATAGAAAGGCGACGGCATCATAACTACTTTTCCTACTATACTAGAAAACGAAT
TACATGGAATTGTCAATGGACAGGATGGTAATTTTCCAAATGTATTTGATAATAACGACA
GTGTTTCTTCATCCAATTCTTTAATAAAAATAATTGTATTAGGTCCTATAATTCTATGCA
TTCTACTATATAATATATTTTCCAACGTATCAATATCATTAATCATATCTATTCTGCCCC
CGTTATATAAGTCTCCATCCGATAAAAAAGTAAGTACATCCATGCAATGAAAAATTTCAT
TTCTAAAATAATATTCATTTTCTAATTCTTTGATATGATCTTTTATTTTTGTTGGTGTAA
ATATATCTTTAATTCTACCATTTCCGGTAAAGAACCATGAAATTAACGTCTTTATTGCAT
CTAATCTATTAGATCTTCCTTTTATAGAATTACACCAAAAACTCATATAACTTCTTGCAG
TTGATGCATTTGCGACATATTTTGATGAATCAAACGATATTAAAATGTGTTCTAACAAAT
GTGCAACGCCCAATATGTTTCCTATATCATTTTCAAAGCCAAAGCTAGCAATTCCTAAAT
AAATATCTTTTATCATATATGGATTTATAAAAATTCTAACACCATTTGATAGCACTATCA
TTTACTAAGGAGTAAAATAGGCAATAAAGTCCTAACATCTTCATCAAAGTCTAATCTAAA
TACGCGTTTTTTATTATCAGATACTACCGTAACCGTTCCAGAAGAAGAATTATAATATGT
ATTTACTGTACTCGGTATAAATTTTTCATTATTAAGAAATATTAACGTATTTAATGAAGC
TGGAAATACATCATCTCTTTTTTTTAAGAGCTTATTTTCAAGATTCAATCTGGTAACAGA
TAACTGTAATTTGTTTGTTGGATAATACATAAAATAATAGGTAACGAGTAAAAATATTAT
AAAAAAAAATATATATATTAAAGGAGATGCCATTTAGAGATATTATTTTGTTCTATCTTT
TAAAATATTTACTTACTGAAAATCATTATTCTATGAGAATGATCATTTCATTATGTAGAG
TATACGATATTAAAATAGAGGATTTGATTGTTTCGGCATTAAGTAAAAAATATTTGCGAA
AATTTTCAAAAATTTTATCGTATCCAGATGTATTATTACCAGAAATATCTATATGTTTTC
CTGAAAATATCATTCACGAATTATTGTTATTAAGAGTGCAAAAATTCTCTAAAAGCATAA
GAGCTAGTTATAGGTTAACTAAGAATATGAAAGGAATAGTTATTGTAAAGAACAGATATT
TATTTGTAGTCCATGCAAATGATGATCTATTGAATTATTTGTTTAAAGAATATAATCCTC
AACTTTATATATATGATATAGGAAAACCATCTGATGTGTGCGGCTCAAAAATGATTTTAT
GCGGATATTCAAAAATAAAATTCTATACTTCTCTAGTCACCAATATAATAACAAATCAAA
AAATTGATATAGTTGTTACAGAAAAATGTATAGAGTTACTGGCACAAAATGAACAATTAG
TAAAGGATTTATTCGATAAAAGTAATGATAAAATAAACAGATTATTAAGACAAGTCTTTT
ATTCAGTTTTAGGAGGTGGCCAAACTCCATAGGGAGCATTTTCAATTTCTTCTCTTAACG
ATTCCAATTTGATGAATGATTTGTCCACAAGAGCTAAATTTAAAAATTTAGATATATTAA
CGAAGGCCATCTGTCCAGTTTCTGGATCATATTTAAATAGAGACGATGCTTCACTACTTA
AATGATTAAAGAAATTATTTATAAAAACAATACCTTGTTCTAATTCATATTCTTTTATTT
GTCCTGTTTTTGAAAAAAATTGTAATATATTTATCCTTAATATAGTGTATTCATCTTCTA
ATGCTTTCATCGCATCACTAATAGATTCACAAATACCACAAAGAGGTTTCCCAAATAAAA
TAAGAGTCTTCTTCATTTATGGGTATCAAAAACTTAAAAACGTTACTGTTAGAAATTGGT
GCTTTAAGAAAAATATCAAATATTCCTTTAGATTCAATAAATGGAATATTCGTAGATACA
ATGAGCTTTTTTGTATCGATAGCTCATTGTGTCAATAATCTTGATGATCTAAATGATATG
TTTTTTACATATATTAATCAATGGGCCAGATATGGAAAAGTTACGCTATTTGTTGACAGA
GGAAACATCATAATAAAAGAATCTCTTAGAGAAAAGAGGCGTACTACATCAAAAAACACT
ACAAAAAGAAAAGTGGAAGAAGTGGATAAACTAAATAACGATATAAAACTATTGGATTCA
AGTTATATATTATATGAAGAAATGAAAACAGATATAGAACTTAGAATAAAAAAACTTTCA
TTTCATAATTTTTTAGCAAATTCTAACAATTTAAAAGCTGTATTAGAAAAATCATTATCA
TTATTAAGCGATAATATAAAAGTTATATATTGTGATGGTATAGATGCAGAATTTGTTATG
TGTAGAGAAGCAAAAAATCTCTCTGAAATGAGTGGAAAATGGCCATTGTTGATAAGTACG
GATCAGGATATTTTATTACTTTCTTCGTGTGACAGTTTTCAAAAAATAATAAAAACAATG
AATCAAATGTATTTATTTTTACCTTGTTCAAAAACTAGATATTTATCCAAACTTGTAGCT
TTAACGAACGGATGTGATTATTTTCCTGGCTTACATGGGTTTTCTATAACTACTAAATCG
CTAGAACATATTCCATTATTTGATGACTTTGTACTCGATAATATAATACAAAGTTTGGTT
ATAAAGAATTATACAAAAAAAGAAAGTGATAGGAACATAAATGTTGATACTATTATTACA
TTCATAGATAGATACTCAAATTTTGATAATGATATTTATTTTTCCTGTCCGTTAGATAGT
GTGACTATTCAAGAATTTATATTTTCTGCCTTATCATACAGATGGAAAAAATTCGACGAT
ACTTTATTAAAGGGAATAAGTTTGTGCGCTTCTTTAATATGTATTTTGGAACCCAAAAAA
GAAATTGTTAAAGAAGATATAAATTATTTATGTAAAATCATTAATGACAATGATAAAACA
AATATAAATCATATAAAATCAATCCTCGATATATTTGGATATGAAATGAATAAAGATAGC
GACATAACATTAGGTATATTAAATCTTAAAAATATAATGTTATGTTTTAATGATATATTT
TATTTTAATAATGAAATTATAATTAAACACAATTATAAAAATAATATTATAAATATAGGA
TAAATGGTATTTCAATTAGTATGTTCAACATGTGGAAGAGATTTATCGGAAGAGAGATAT
TTATTATTAATAAAAGAAGAGACGTTAAAAAAAGTGTTGGATAATGTTAAAAATAGCTGT
TGTAGACTTAAACTTTCTACTCAAATAGAATCACAAAGAAATTTAACTGTACAACCATTA
TTAGATATAAATTGATGGATCCTATCACATTCATTAAATTTAATGTACCAAAGGGTGCAA
TTATTTTTATAAATTATAGATTTTCACTTACTGAACATTTTAATCCGTCGGAAGATAAAC
ATGCGGCTATATATTTGGGAAAAATAAAAAAGGAAAATCTTATATCATGTAAAAGATCAT
TTGATGAAAATGAAGTATGGGCTATAGAAGCGTCGTACAAAAACGGAGTTAATTTGATTA
CCCTGGATGAATTATTAAAGGGGGCTCTTAATATAAAAATATTTATATTGGACGACGAAC
TTTCTGAACCAAAAATGTCAATAGCTGCGGACATATCATTAAAATTTATAGGTATGCCAT
ATGGATTTGGATCTAACCATATATATTGTTTTAAGTTAGTTGCAGAATCATATTCATATC
TGGGAATAACTATGCCGACATATAATATCTTAGGCAAAAAGATATACCTTAGTCAAAGCT
TTACACATAGCGGACATTGGAAAAAGATTTACGAAAGTTAAAGACAAAGACCTTTTTATT
ATTTAATGGAATTTACTCCTGGAATTGTTATACTTTTAAACGGAGAACTTATATTTAGTG
TAATACCTTGATTTTTACAATCTAAATTTTTTCTTTTTATATTGCTCGCAATAACTCTCA
TGATATATAGATATTCCAATATAGCAAACATTTCAATATCAGATGCAGAAAAGGGTATTT
GATTAATAATTGACTTTTTAGTTATGGGACTAGAAATAGATCCATCTAACACATTTCCCT
TTGAATATTTCTGTGCATCTTTTAAAAGCTTCATCGCATACATTGAGTTTCTTTCTTCTT
GAGTTAGCGGCTGTATACTGATAATTTGTTTATCCTCTTTACTAGTTTCATCATTTTTCT
GTTCATCTATATTATTATTTTCGGAAAGTTCTTCTATTTTTAATCCGGCTACATATTCAG
CAAAATTATTTGATGTATTTATTCCTTTTTTTGTTAAGAATGCATACACTGCTTGAATCA
TGTCTGACTTTACCGGTAGATTTAACAATTTATCAATATCGTCTCTATAATCTATATTGG
ACGATCCGGCAGAAAAAATAATAGGCGTCATCGCAGAATCTTTATTGCCTAATATAATAG
GAAATATCTTATATTGCACTAAATTTATCAAAGCATACTTCATATCTAACAGGTCCGCCA
ACTCTTGTGATAAGTTTTTTTGAGATGAAAAAAGATACGTTTCTATATATTCAACCATTT
CCGCCGCATATAATAGTTTATTTGATAAAATTAATGTGATAAACATAGATAAAGTGGTTA
TAATTGTTGGCATACATGTTGTAAAAAATGATTTACAATGAGTAAATCTGGTCAAAGAAT
TGTATAATCTCCAAAATTCATTAGTATTGCATACATACATCGATTGATGTTTTAAATTAT
TTAATATTTGATTAAGATGAGAGATATCATCCATATTAATCTCATGTTCAAGATACGAAT
ATATATTATTGATTATAGATTCCTTATACGACATGTTATTACAATAACATAATTGTTTTG
CTTTATTTTCTATATATTCTGAATTTATATTCGTATCTTTAACAACAGATTTTACTATAG
CCTTTGAAACAATAGTATAGATCGCTGATTGTTTAGGTTCAATCATTTAACTTTAAATAA
TTTACAAAAAATAAAATGAGTCTTCGTATAAAAATAGAGAAATTGCGTCAAATTGTTGCT
TATTTTTCTGAATTTAGTGAAGAAGTTTCTATAAATGTAGATTCAAATAGTAATTTAATG
TATATTTTTGCTGCGTTGGGTGGGTCTGTAAATATATGGGCAATTGTTCCGCTAAGTGCT
TCTGTATTTTATGATGGAGAAAATAATCAGGTTTTTAATCTTCCTGTATCAAAAGTAAAG
GCCTGTTTATGTAGTTTTCATAATGACGCTATCATAGAAATTGAACCTGATTTTGAAAAT
GACTTAATTAAGCTATCTAGTTTCCATGTTGTAAGCGTTGATTGTAATAGGGAACTCATG
CCTTTAAGAACAGATACTTGTATCTCGTTAAAAATTGATCAAAAAAAATCTTATATATTT
AATTTTCATAAATATGAGGAAAAGTGTTGCGCTAGAACCGTTATACATCTAGAATTATTA
CTAGGATTTATAAAATGTATAAGTCAATATCAATATTTGACGATACTTTTTAAAGATGAT
AATATAATACTAAGAACTCCTGGAAATTTAGATACTTTTTCAAGAGAATATTCTATGACA
GAATGTTCCCAAGAATTACAAAAATTTTCATTTAAAATGGCTATAGCCTCATTAAATAAA
TTAAGAGGCTTTAAAAAAAGAGTAAATGTATTTGAAACAAGAATAGTAATGGATAAAGAT
GACAATATATTAGGTATGTTATTTAGTGATAGACTTCCGTCTTTTAGAATAAACATATTC
ATGTCATTCCAAGATTGATTATGATTATATTTTTGTTTAATAATATAAATAAAAATGGGT
GCCTCATTCACAATTCCGGATAATGTCAAAAGACCCCCTACACCTCCTAAAAAAACATCT
GAAATGAATTTAAATGTGGATAATATGTATGAGCTAATAGGATCATTAAATCAAATTAGC
GATGTTTTACATATTGGCATAATAACAGATGATAAAAAAAAACAATTAGAAAGAAGATTT
CCTGAATTCTTATTTATGAAATCAGGTCCTGGAAATCTATATAATGTGATAAGATCTACA
TATACGAATGATACCAAATATTGTTGTAAAAATCTCAAATTAAAAAGTTATTGGAAAGAT
TCAGATGGAAACATATCAATTTTATATCGACCGAATACTATTTTAAATAGTTGCGATCCA
GATTTACAAAACAGCGGCAAGTGTGATTCGGATTTGTTTTCTTGGTGTCAATCAAATACG
TCAGATAAAAATATATGTAATGATTGGATGTATACGATGCTATCAAGGGATAATACCGCG
ACAGAAACATTAATAAATAAATTTATATCTTTATGTTCAAAAAATGCAGATGTTCCAATA
TGCGAAATGTTTTTACATAATTTAAGGGCAAAAAACACAGAATCATATGATAATGTTATA
GATTATATATTATATCTGCAAAGCGATGATTTTAAAAATACATATATGAGATGCAGTTAT
CCAAGTACAAAAACATTAGAAGAATCATTAAGATATTCTGAGGCAAGAGAATGTTGGGAT
CCAGAATGTGCAAATGCTAACGTTAATTTTCTATTAACTAGAAATTATAAAAATTTAGGA
TTGTGTACTATTAATAGATGTAATGTAAGTATCAATCATTTAAACATCGATAACAAATCT
AAGCTGCGTATGGCGTGTAACAATTTAGATCTTACAAGTCCATATCCCATAAATAGAGAA
AAGGTAATATTACATAATATAGATAATTCGTTTGAACTTAAAATTCATTGTATAACTATA
TTATCGATTTTAGTTATATGGTTATTAATTGTAGCTATTTAAATGGGAGCGGCCGCTAGT
GTACAAACTACAGTAAACACATTAAATGAAAAGATTAGTAATAAGCTAGAGCAAACGGCG
GAAGCATCTGCTATAGCAAAATGTGATATAGAAATTGGTAGCATAACTTTCAGACAAAAT
AGAGGATGTAACGTCACTGTAAAAAATTTATGTTCGGCTAAGGCAGATGCGCAATTGGAT
GCCGTTTTGAAGGCTGCTACAGAAACTTATGATTCTTTAACTCCGGAACAAAAAGCATAT
GTACCCGGTTTAATGACCGCGGCATTAAACATACAAACAAGTGTAAATACAGTGGTGAAA
GATTTTGAATCGTATGTAAAACAAAAATGTACATCGAAAGCTATTATTGATAATAAATTA
AAAATTCAAAATATATTTATCGACGAATGTGCCGCGCCTCCGGGAACTCCAACAAATTTT
GAATTTATTAATTCTGGAACTAGTCAGGGGATATGTGCCATAAAAACATTAATGGATGTA
ACTACAAAAGCTAGTACGACTATATCGCCTTCACAAAGTTCCGGATATGGGTATCAAGCA
TATGTAATAGCTGCGGTTGCTGTAATATTTGCCATGCTATTTTTATATTATGCAAAAAGA
ATGTTATTTATGTCTACACAAGATAAAATAAAGATTATATTAGCAAATAAGCCAGAGGTT
CACTGGACTTCATATTTGGATACATTTTTTAGTAATATACCAACCATTGTTGATGAAAAT
AATGCAAAATAGATAAAATATCTATCGATAATTGAAAAAATATTAATTTTATTTTAATGG
CTGAGGTATTAATAAACAAGTTGAGAAACATAGAATTGGATAATTATGGAAATGAAAAAA
TTATAGATTGTATAATTTATGAAATAGAAAATACACAATATGTAATTGTTAGACCTATTT
TAAGATTGATAGTTGATTTGATGATTTTACTTATAGTGTTAAACGATGTAATAATTAGAG
TAATAAAAAGAAATTATAAAATTTTACTAATTTCTTCATTTTGTGTATCTATGTTATATT
TTTTGATCCATAAAGAAGAAAATTTAAATGACAATGGCAGTTAATTGCGATCGTATAAAA
TACTCACCCGCAGGATATATATCTTGAATATTAAAATCATCAATTTCTAAAATATATCCA
CCATCTGATGAAAATAATATTCTAACATTATCGCTTATAGAGACATGTGTTAAAGTTATT
CCAGCTACATATGCATCCTCTCTTAAAACCAATACAATTGTTCCCGGTTCTATGAATCTA
TTTACATGATTTCCGCTAGCATACTTTCTCTTAATTCTGAATAAATCAGCACCATCTTTA
GCCAATAAACATAAGTGATTTTTTATCAACCATTCAAAGAAATAATTTGATGTTTCATAT
CCTTTTCTAGATACTGTTTCAAAACAATGTAAAAAATCTAGATAACAAGATTGTGGTAAT
TTGACTCTATATGGTCGTGTAGACAATGATAATATAACTAATTTTTCGGTACATATTTCA
AATATTAGTTGGTTTACCGATATAAGAAATGTGGTTTTAGGTATTGTTATGACATCAAAT
TCAAAATTATCTACATATATCTCTCTCTTATACATAGAATATAATATTACAGCAATCTGA
AATAAAACAGATTCATGTATTAGTGGAGACGATGGTTTAAGTTTTTCAATATGCATATTT
TTAAATTGTTCAAAATACAACATTTTTCCATATGAAAAACTTCTAAATCCTCTTAGTAAT
GGGAAGCCTATAGATTTCCTTGATTTAACCAAGGAGGAAAGCTCTATCCAACATTCTGTC
TCATCTTTTTCTGATTGTTTAATAATACAATTTATTTTTATCGATCCATTTTCTAAATCA
GAAGATTCTCTCTCATGTATCATTAATCTATTAGTTAAAAAATCTTCCTGTTGGCAATAT
ACATATTTGTTCTCTAAACAATCTTTTTTTTTTACGAACTTATTTTCTTGATATTTTTCA
TTTTTTTTGTTTGGTATTTCATGCTGTTCTTTATTGCGATATCTATTATTACTGGTCATT
TATCACAAAAAAAACTTCTCTAAATGAGTCTTATTCTAGAAAACTTGTTTGATGAAGATA
TTATATTTTGCGCTGGAAGTATATTAGACTATTCTGACATTAATCTTATTATTGCGGGTG
CAAAAGTTAAATATCCAAGATCATTTTTATCTATTTTTAATATTATACCTAGAAATATGA
CAAAGTATGAATTAGAACTTGTTCAAACTGAAAATATTACAGGAGCTGTTTTTTCTACAG
CGTTTAATATAAAAAAAAATTTAGGCATTACCGATGAAAAATTAACAATAGAAGCGATTG
AAAGTTATTATTTAGATCCTAATAATGATGTGTTAACACTAATGATTAATAATACATCAT
TAGATGGAGTTACTCCCAGAAAAAGATCACGAAGAAATAAAAATCCTGTATTATTTAGAC
AAGGTTCTGTGCCATTATTTTGTATTTTTGATTCTAGAAAAAAGATAGGAGTGTATAGGG
AAAATATGAATTCCCCATCAAAAGATAATTCATATATGCAAATAGAAGATAATGTTGCAT
TAATAAATAAATACGCTAATATGTCATTATTAGATGTGCATTCCCCATCCGCATCTATGA
AATTAAATGCTGTATATGGATTTACTCATAAAAATGAATTGAGAAAATTGGTTTCTAATA
AAGAAATAGAAGAATATAGTAGAAAACCCTTGCAAGAACCCGTTAGATTGAATGATTTTA
TTGGTCTTTTTGATTCTGTCAAAAAAAATATACCCTTAACAAATATTCCCATAGCAGAAT
AATATTTGTAAGGTGTTATAAATGGAGAAAAAGCATTCTAACATCTATTTTACTCCTGTG
TTTGTTGAGCCTACCATAAAACATTCCTTATTGAACGCCTATAAATATACATATATTGTT
CTTTTTGAAGTATTATTTGTAGCATTTTTATTATATCTATTTTTTAGATCAGAGATTATG
ATGTTATTAAATTATAAAAACGATATGGTAAAAGACCCATTAGAAAAATTTCTAAAAACT
AGTTTATCTTGTAACGGAGATAAGTTAATAATAAATAAGTTGCCAAATTCTTCATCCAAT
GTAAATGCATTAGCTATAAATAGGACCCCTATAACGAATAAAAATTGTAAAGCTCTATTA
CAGTCAATAAATGGATCACAACAAGTATCTCTTAACGATATTCTTAGAAGATAATGAATC
ATTTTTTAAATATATCTCAGAACAAGATGATGAAACGGCGATGTCTGATATAGAAAACAT
AGTCAACTACTTAGATTTTTTATTATTATTATTGATAAAATCCAAGGATAAACTTGAATC
TATAGGATATTTTTATGAACCATTATCTGAAGAATATCAATCATTGATAGATTTCAGTGA
TATGAAAAATTTTAGGGTTTTATACAATAGAATTCCTATCAATGTTACTCCAGAATCATC
TATCGAACTAAATAAGGGATATCTATCAGATTTTGTTATTTCATTAATGAGGTTAAAAAA
AGAATTTAAAGGAAGTGATTCAGTTACAAAAACTATTACATATATAGATCCTAGAAAAGA
TATATCATTTTCTAATATATTATCTATATTGAATGGAAAATGAATAAAAATAATAAAAAT
AATAAAATGGGGTTTAATGGAAGTATACAACTAATCTTGGGTCCTATGTTTTCTGGAAAA
AGTACAGAATTGATAAGATTATTAAGAAGATATCAGTTGGCAAAATACAAATGTAACATA
ATAAAATATTCTAAAGATGATCGATATGGGAATGATGAGTTTTTATATACACACGATAAA
CTTTCTATACCCGCAATTTCATCAAAAACATTAAATGAAGCATATTCTCACATTATTGAT
GTAGATGTTATTGGTATAGATGAGGGACAGTTTTTTCCAGATATTGTTAATTTTTCGGAA
TCTATGGCAAATATTGGTAAAATTGTTATTATCGCCGCCTTAGACGGTACTTATAAAAGA
AGTCCGTTTAATGATATTTTACAACTTATACCATTATCAGAGAAAGTTATAAAACTAAAT
GCGGTATGTATGAATTGTTATGGAGACGCATCTTTTTCAAAAAGAATTAGTGACGAAAAA
GAAATAGAGATTATAGGAGGAAGTGAAAAATATAAATCCGTATGTAGAAAATGTTATTTT
ATGTACAAAGAATAATTATTGAAAATATATATACAAATAATCGTTCCAGGGATTATAACC
CTTTATTTTATAAAATGGGTATCACACACGAACTTGACATTCTCATAGTATCTGAGAATT
TATCCCTAAAAAATGTTGAACTTCTTAAAGGTGATAGTTATGGATGTCTCATAAATATAA
AGGTAAATGGACAAAAAACATTTGATTTTATGTTTATATTGAGACCAGATTGGACAGAGG
TACAAAAAGTAAAGTCCATTAAAATGTTAAATAATGGATTTCCGGTGGAGGTGAAAGTGA
TTAAAAGTTCTCTGTTTGAAGTTATATATCAAGCCTCATTTACTACTTGTTTCAATACAA
CTCTAGAGATTTTCAGTGATGATTTTAAACAACAATTTAAAGAAAAATATCCAGTAGTTA
ATATTAATACCATTAAAAAGGAATATGAAATTGTAAGTTCCGGAATGACATGTATAAATT
TGGATTCACCAATTTGTGATGAAGATAGAATTAAATATACAAAATATGATTATAGTTTTA
TAGGAGATAGTTATAATGAAATTGATTATTATGCTACGGATAATGAAGAAGATTCTGATG
AGGATTTTGAATATGATACCGATATCGAAGATGATACAGATGATGGATATTCTGATGAGG
AAGACGATAATTGATTTTTTTTGAAAACTAATGATCAAATTGTTAAAAAGAAGGTCAAAA
TCTACGTTAAAAATGGAAGCAATATCTATGGATAAACCATTTATGTATTTTGATGAGATA
GATGATGAATTAGAATACGATCCTAAAAGTGCCGAAGAAAAACCAAAAAAGTTACCATAT
CAAGGACAATTAAAATTATTACTTTGTGAATTATTTTTTCTAAGTAAGCTACAAAGACAC
GGAATACTAGATGGTGCCACTATAATTTATATAGGATCTGCTCCAGGAACACACATAAAA
TATATTAGGGATCACTTTCTTTCTATGGGTTTAATAATAAAATGGATATTAATAGATGGT
AGAAAACACGATTGTATATTAGAGGGTCTTAGGGATGTACAATTAATAACAAAATTTGTA
GATGAATCCTATATAAAATTTTTAAAAAAGAAAACATTTCCATCAAAAATTATTCTTATA
TCCGATGTACGATCCAAACGTGGAGGATCAGAACCATCTACGAGTGATTTGTTAAGTAAT
TATGCGTTACAAAATATAATGGTGACAATATTAAAACCTGTAGCTTCTAGTTTAAAATGG
AGATGTCCGTTCCCAGATCAATGGATAAAGGATTTTTATATCCCATATGGAAATGAGATG
TTACAACCATTCGCACCTAAATATTCTGCAGAATTAAGACTAATAAGTATATATAGCGGT
GACCCTATTAAGTTACGCTGTATTACTAAAGAGGATGCCTTAAAATATGAAAAAAAGATG
TATTATCTTAATAAGGTGGTAAGAAATAAAATAGTTATTAATTTTGATTATTCAAATCAA
GAATATGATTTTTTCCATATGTATCATATGTTAAGAACTATATATTCTAATAAACCGTTT
GTATCTATAAAAGCAAAGGTGTTATATTTTCATCAATCAATTTTTAAATTTTTAAAGATA
CCATTAACATATACAGAAAAAATAAATAATGAACCAACACAACGTAAAATATCTAGCAAA
AATACTCTGTCTAAAAACAGAAGTACTAAGAAATCCTTATGCGATAATAAGTAAAGATAT
ATTATCAAAATATTATACAGAGATAAAATACGATGATTTGATAACCATAATAACCGTCAT
TCATAAAATAGATTCGGAAAAGGTTGTGTTTCAAGTGTTTAATGAATCATCCGTATTATA
CAATCCTGTTGAGAAAGATTACGGTTATCCAATCATAATAACATCATTTTTGCAGATGGG
ACATAATAAATTTCCTGCGCATTTTCTTTATATAGATATTGTTGCATCTGATCTATTTCC
TAAATTTGTAAGACTAACTCCAGATGAAATTAATATTGTTAACAGTGTATTACAGATTGG
TGATAGCAAAGATTCTTTAAAACTTCCAAAAATGTTAGAAACAGAAATTTCTGCTAAAAT
TTTATTTCACAAGGATTATCCGTTAAAGATAATAAGATTCTTTAGAAATAATATGGTAAC
CGGTTTAGAGATATCTGATAGAGTACTCATTACTGTTTTAGAATAAAGATTATAACATAG
TTAAAGTTAATCCAGTAATTGCCATCAATAATATCGGTATCCATTTTGGATGTAATATGG
GATTTTCTATATCTTGATTTAAATATCTGGTATGTACAATTTCATTGGTAAGCAATGTAT
TTGATCCACATACATTATTCACATCTAAATAACCATTTTTAAGTTTTACATTTCCTAAGG
ATATTATACAATCAGATACATTGCATCTCGATATATTTTTTTTAAGAGAAGCTACTAATA
ATGCGTCTGATCTCTTACAAGGTTCATACCAACAATAGTACGGCAATCTGGTCTCCTCCC
CTATTTTTATTATACTCTTATCAGGATTTATACATCTACATCTAATATCATTCTTGTTTT
TATCACAAAAATTATAAATTTCTTCATCTGACATTTTTTCCATGATTATAAAAATTTAAA
TATATAAAAATATATTAAAACCACTCTTATAAAAAGGAAAAAAAACAAATAAATAAAAAT
GGCAGTAATATCGAAGGTAACGTATAGCTTATATAATCAAGAAGAAATTAATGCAACAGA
TGTGTTTATAAATCATGTAAAAAATGATGATGATATAGGTACCGTCAAAGATGGTAGACT
AGGTGCTATGGATGGAGCACTTTGTAAGACTTGTGGTAAAACAGAATTACAATGCTTTGG
TCATTGGGGAAAAGTTAGACTATATGAAACTCACATAGTCAAACCAGAATATATAGGAGA
AGTAATTAGAATAATTAATCACATTTGTATACGATGTGGATTTTTAAGATCTAGAGAACC
ATATTTAGAAGATTTAACTAAACTTTCATCACACGCATTAAAGAAGTTAAAAGATAAAGT
TTTATCAAAGAAAAAATCTTGTTGGAATAGCAAATGTATGCAACCATATCAAAAAATTAC
ATTCTCAAAAAAGAAAGTATGTTTTGTTAATAAATCCGACGAAGTCACTGTTCCTAATGC
ATTAATATATCAAAAACTTACATCTATTTACAAACGATTTTGGCCTCTATTAGAAATACA
CCAAAAGCCAGAAAATTTATTTTATAAAAATTTTTTCCCCGTACCTCCTCTTATAATAAG
ACCAGCTATTAGCTTTTGGATAGATAGTATCCCGAAGGAAACAAATGAACTCACTTATTT
GTTAGGCATGATTGTGAAATATTGCAACATGAATGCTGATGAACAAGTAATACAAAAGGC
TGTTATAGAATATGATGACATAAAAATTATTTCTAACAACACTACAAGTATTAATTTGTC
ATATATTACATCTGGTAAAAACAACATGATAAGAAGTTATATAGTAGCTAGAAGAAAAGA
TCAAACAGCTAGATCTGTAATTGGTCCAGACACATCGTTGACAATAAATGAAGTTGGGGT
ACCGGCATATATAAGAAATACTTTAACCGAAAAAATATTCGTAAATCCTTTTACCACAAA
AGATGTTCAAAAATTATTTATCAATAATGAGGTAAAATTTTATTTTAATAAAAGGTTAAA
TCAACTTACAAGGATTAAACAAGGTAAATTTATCAAAAATAAAATTCATATGTTGCCTGG
TGATTGGGTAGAAGTACCTTTAAAGGAAAATACTAGTATCATCTTTGGAAGACAACCATC
TCTACATAGATATAATGTCATAGCTTCTACTATTAAATATACAGATGGTGATACGATAAA
AATACCCCCAGGAATAGCAAACTCACAAAATGCAGATTTTGATGGAGATGAGGAATGGAT
GATATTAGAACAAAATCCAAAAGCTGTTATAGAACAAAGTATTTTGATGTATCCAACAAC
GTTGCTAAAACACGATGTTCATGGAGCTCCTGTATATGGATCTATACAAGATGAAATTGT
TGCAGCATATTCATTGTTTCGTATGGAAAATTTGACAGTAGATGAGGTTATGAATTTATT
AGGAAAATACGGATTGGGATTTGATACAAAAGGTAAAATTACATTTTCAGGAAAAGATAT
ATATGAATATTTGATAAATGAAAAGCTAAATTATCCTGGAATTCTTAAAGATGGTAAAAT
CATAGCTAATGATGTAAGTAGCGATTTTGTGGTTGCTATGAGACATATGTCATTATCCGG
TTTATTATCTGATTATAAATCTAATGTTGAAGGAATTAATTTTATCATAAAATCATCTTA
TGTATTTAAAAGGTTTTTAGAAATATATGGATTTGGTGTTACGTTTAAAGATTTACGACC
TAATTCTGAGTTCACAAACAGATTGGAAGCCATAAATGCAGAAAAAATAGAATTAATCAA
AGAAGCTTATTTAAAATATTTGATGGACATAGATGCTGGTAAAATATTACCATTGTCAAA
GTCTATGGAATTAGATGCTGTGGAGTCGATGCTTTCAACATTAACAAACTTGAACATAAA
AGAAATAGAGGAATATATGCAACAAACACTTAAGGAAAATCCAAATAATAATTTATTGAA
GATGGCTAAAGCCGGATATAAAGTTAATCCTACAGAATTAATGTATATTTTAGGAACATA
CGGTCAGCAACGAATAGATGGAGAGCCTGCAGAAACAAGAGTCATGGGTAGAGTATTACC
CTATTATTTACCAGATTCGAAAGATCCGGAAGGTAGAGGATATATTCTTAATTCGTTAAG
TCAAGGTTTAACAGGTTCACAATATTATTTTTCCATGTTAGTCGCTAGATCACAGTCTAC
TGATATTGTATGTGAAACGTCAAGAACCGGAACATTGGCTCGTAAAATTATTAAGAAAAT
GGAAGATATGGTTGTGGATGGATACGGACAAGTTGTTTATGGAAATATTTTAATAAAATA
TGCAGCAAATTATACAAAAATATTGGCATCTATATGTAAGCCTGTTGAATTGATTTTCCC
ACATGAATCTATGGTATGGTTTTTTGAAATAAGCGCATTATGGGAAAAGATAAAAAATGG
ATTTATATATTCTCAAAAACAAAAAGTTGCAAAAAAAATATTGGCACCATTTAATTTTCT
TGTATTTTTGGAAAGCGCACCGGATAACAAGGCTATGGGTTCAAAAGAATTATATGATAT
GATTCAGACGGTTATCGAAGATGTAAAAGAAAAATACTTTTTTACAATAGCAAATATAGA
CTTTATAGAGTATATTTTCCTTACTCACCTTAACCCATCTAAAGTTAAGATAACAAAAAC
AACAGCTATAAATATATTTAAAAAATTTTATGAAAAACTTAATTATACATTGGGAGGAGG
AATGCCGATAGGAATAATTTCTGCACAAGTATTATCAGAAAAATTTACACAACAGGCATT
ATCTAGCTTTCATACAACTGAAAAAAGTGGAGCCATAAAACAAAAACTTGGATTTAACGA
ATTTAATAATTTAACAAATTTAAGTAAAAATAAAACTGAAATAATTACACTAATATCTGA
AGATATAGAAAAACTTCAAAATGTTAAAATAAATTTTGAGTTTATTTGTTTGGGAGAATT
AAATCCAATTATAAAAATTATAGAAAAAAATGATGATGTATATACCATCGATATAATTAT
TAATAGAATATATATAAAACGAGCAGAATTAACGGAACTCGTTATAGAATATATGATAGA
GAGATTTATATCATTCAGTGTTTTAGTAAAAGAATGGGGACTGGATACCACAATAGAAGA
TGAATTAAATATAAAATTTACAATGTATATAAAATTTGTTGAGCCGAGTGAATTATCTCT
TAATAAGTTTATGATGGTGTTGCCAGGAGCGATAAATAAAGGTAAAATAAGCAAATTCAA
AATACCTATAACTGAATATTCTTATTTTGAAGATTTTAATAAATCTAAAAAAATGTATAG
AATGACGGTTGAATTGATGAATTTAAAGGAATTAGGATCATTTGATCTAGAAAATGTGAA
TGTATATCCGGGTATATGGAATACATTTGATATATTTGGTATAGAAGCGGCACGAACCTA
TTTATGCGAGGCATTGTTAAATACATACGGTGAAGGATTTGACTATTTATACCAACCTTG
TGATTTGTTAGCAAGCTTATTATGTATGAGCTATGAACCTGAATCGGTAAATAAATTTAA
ATTTGGATCTATAAGCGCCTTAAAGAGAGCAACATTTGGCGACAATAAAGCTTTATTGAA
TGCGGCATTACATAGAAAAACAGAACCGGTAAACGATAACAGTAGTTGTCATTTTTTCAG
CAAAGTTCCTAAAATAGGAACTGGATATTATAAATATTTTGTAAATTTAGAACTATTAAC
TAGGTTAGAGAAAAAATTGTCGGCAAAAATAGCAGAAAAAAAGGTCGAAGATTTAGAAAA
TGTGACAGAAGATTTTTAAATAGGTTTTTGTTATATCATCTTTCATTAATAATATATTTC
TCAATTATTTGTTTTCTGAATGATGGATTCTCTAAAAATGCACCTCTCTGTTCTCTCATA
GAATGATAAATATATAAAAAATATATAAATGCCGGTATATCTTTGCTCCGTTTTGTCATC
AAATATGCCATTATCATCGCTCCGCTTCTGTTAACTCCTGCGACACAATGAACTAAAACA
GGATATTGTTGAGCATCACATTTAGATAAAAAATCTGTCACGTAATCAAAATGTTTACTT
AAATCAGTTTGTTCATCATCTATTAACGGCATATGAATAATATTTATATGTGAATTTTTT
AATGTATATTTTTCTGTTGTTAAATTTAAAATGTATTTGAATTGTATATCTGAATATGGG
GCATTTAACGCATCGTTATAATTTCCTAGATATACATAATTAGTCACTCTCATCATTTTA
TTTGGAGCTTTTGCCTTTGGCAATGAACCTGTAGACTTTAATAAAACGTTTTCATACAGA
CTTTTTTTATCCATTTATAATGGATACAAATGGATAAAACAACATTGATGGTCAACGGAT
TAGAATTAGATTATGCGAGAGAAAAAGAGGCAAAAGGTATACAAGCAGCAAAAAAATCAA
CATTATGCTTTTTTTTATTTATATTGGCTGTTAGCGTATTACTTCTATGGTTTCAAGTTT
CTGATAACTCCATTTTATCAGAATTAGTTAAGTATACACGAATAAAAAATAATATAAAAG
GATGGAGACCTTTAGTGGAATCCAAGACAAAATTAGAAAGTGATAAAGGAAGATTATTAG
CCGCAGGAAGAGACGATTTATTGTCGTTTCATTGTGTGGATTTTGGACAATATATTCTTC
CTATAAGATTAGATAGAAAGACATTTTTGCCGCAATCTATAAGAAGAGGAATAGGCGATG
GATGGATGATACGCAAAGCCTCAAAAGTTGATCCCTCAGCACAACAATTTTGTGAATATT
TGATAAAGAACAAATCTGATAATATAATAACTTGTGGCATAAACATGATGGATGAGATAG
GATATAGTGGCTATTTTATGGATTCTCATTGGTGCAATGATTTTCATAATTTATTAACTT
AATTGGATTAAATAATGTACGTAAACAATATACCAGCTATAAACCATAACAATTTTGAAT
TGACGTCAAAAATAGCCATAATTATTATAAATAAAATTATTAAAACACCAATGATTGTTA
CATCAAATAATCCAAAGAAAGAAAATAATGGATGTGATAGAATGTATGCAAAATCTGGAA
ATCTGGTAGATATCCATTTACCAATTCTATTCCAAATTCCATTTCTCATATCCTTAACGC
GTTTATCAGATATATATTTTATATTATGTTCCAAATATGTGGCTGCGTCGTTCAACACTT
GTCTATTTAACCCTTTTTCATTTTCTAATCTGTACATTTCAAATCCTAAACTTGTTGAAA
TTCCATTCATCTTTAAAATCTCATGTATTAGCTCTGTAGCAGTAGATAATCTAATAATAT
AGGCTGATAAACTAAAATCATAACTTCCTGTATATGAATACATTGTTTCTTTATTAGGCT
CTTGATTAAATAATGTGCGAACATTATTATTATGCAATATTTCTCGCATTTGTAGGAAAT
CTATATTTTTTTCTTGCATTGAATAAATACATCTATGCAGTGTTATTATATCATACAGTG
TATTATCGTCTTCGATTACAAAAATAAATTTATTCTCTTTATCTAATATACTTGCCTGTG
CCAGTGATTCCCATAAACTAAAATGTTTAACAATAGATTCTTTTATTTCAGATGTACACA
TAAAATTACAGAATCCTGAAAAATATTCTTTAAAATTTTCTATCCCTCCACTATGTTCAA
CTCTTTTCCAGTTATAATATTTATACGAAAAAGAGAGATCTTTATCTTTTTCTAATGAAA
ATCCAGGAGTTTTATCTTCTTTGTTTATTTCATAAATATCTTTTGCGGAAGACGATTCCA
ATTGCATATCAGGTATCACATCGAATCCGGATCTTCCAACTATAGGTATTATAAATACAG
AAACTTCGAATGGTGTAGGTTTCGCCATTTAGTTATTGAAATTAAATAAATATAGCTCTC
TAATTCTAGTTATGTTTTCGTCTATCCATTCGGAAACATTATTAACATATTTAGATAAAA
ACCTAAAAAAAGTATACTCTAATTCGTCCCTATTGAGAGATTTATTAAAGTATACAAACA
CATCACTATCTGGCAACAAGTGATATCTTAGTAAATTATAACAATTAATTTTATGTTGTA
CGTGATTATGATCTATTAATTCATCATCAAAAGGAAAAGGATCACCAAATCTAAACACAT
ATAAAGATGGTATAGAATAATAATACTTTAGTACATTGTTTATAAATAGATTTTTTAATG
CTATTATTATTTTTTTCCTCTCGATTTCTATCTTTAAATGTGTAGGAAATATAACTAATT
TAATAGCATTTGTATCATTATATCTTATTAATACTTTAAGGTCATCATCCGTTGTTATTT
TTTTAAATTCATTCCATGATTCCTCTGTATTATCGGCAATAGGGATTGGCTTTATTAAAT
TTTTTGTATATATCTCAGCTTTTTTTAATGGAACCATATTTTTAACAATTATTGTATGAT
TGTTAAAAAATTTTATAAAAGATAATGGAGGATCCAACATTTTAACTTCTACATCATAAT
TTGGAGGTTCTATAGACCTTTGTATGGACATAAGTTTTCTAAGTTCTATTATAATTCTTT
GAAGATGAGCGTTTAATTCTTCAGGCATAATACTGGTATATACGTCCGTTAATAATATTA
TAGTGTCTAAAGATCCTTTTTCACATATTTTTGTTTTTAATAAAAAATCATATATAATTA
CAGATATTGAATATTTCAATGTTGTTTCATCCACTTCTTTTTTCTTTGCGGACATGTATG
ATACTATAAAATCCGCACTACTATTTAACAGAATTACTAATACAACGATATAGTTTAAAT
TTAAAATTTTTGATGAGTAAAACAATTCTGTTGATGAAACATGAATGTCAAATAAATTAG
CAGATAATCTTAAAAAGAATACACCCTTTTTTATTTCATTTAAAAATCTTTTTTCATATT
TTTGCCTTTTTGAATTTATATCAATTAAAAAATTTAATATAATTCTGTTTATATTATATT
TCATTACCCATGTTTGTGATTTCATAATATTGTCAAAAGACATAATTATATTAAAGATAA
ATCTTTGACTATGTACAAAATAACTATATGGTTCACTTAAAAATATAGACTTATTATACG
TGGATACTATTACATTATTCTTAATTACATCAACCGCGTCAAGATTAAAATTGGGTACAT
TAATGCCACATATTTTACAATACGCAACGCCATCTTCGTAATAAATAAATTCATTAGCAA
AATTATTTATTTTATTAAAATATTCTGTATCTATTTTCATAGTTTCTATAAGTTTTATTT
GATGTTCACACGGTATAGATTCAATCTGGACCTCTTCACGCCATGATTTCGGTTCATAAA
TTTCTATTTTATCTAATTTTTTACCATCTTTGAATACCGCGTCTTTTTCATTAATTAATT
CCAGAAATAAATCTCTTAAATAATAATTAGATAAAAAAATATAACTGTACAAATATTTAT
TTTTTAATTTTGGTATTATTAATTTCCCCCAATCCATTAAACTATTATTGTGATCTTCAG
AGAATGAGTTTTTATATGTTTTATTAGTTTCTTCCAAATACACATATTTTACGTCCAAAA
AATCTTTAATAACAATAGGTATAGTGACACCATCCACTTTATATAAATATATATAACGCA
TATTTAGTTTTCTCTTAGATATTGGTATCCCTATATGTCTACAAAGATATGCAAAATCTA
AATATTTTTTGGAAAATCTGAATTGATCTAAATTTTTAGATACATAACTTATCATATCTT
TCATATTGAATGGTATTTCCCTTACTTCAGGATCAACATTAGTATCAAATTCACTAGTTA
AATCGCTAGTCCTATAATTTACAGTTATATCACCATTTAACTCATCATTAACTAAAACAT
TTATCCTTCTTTGTTTTAAATACATGTCTAAATTGTTAAAGAATAGATTATAAAGATTAA
ATGTCATCTCGTCTGTAGTTGAATTTTGTTCATGTATAAATAAACTCGAAGTTATTTCTT
CTTTAATATTTTGTTCAAATTTATAACCTATATATGAAAATATTGAAATTAATGTTTGAT
CATCCACATCTATATTTTGTTCTATCGTTGCATATAATAAGCGTATATCTTCTTCAGTAA
TGGTGGATATATTATACAGATTAATGATGAAAATGTTTTTATTATTAGATATGAAATCAT
TATATGATTTTGGACCTGTATTTGGATTCAACAAGTAATCTTTAATTTTTGGAATAATGT
CTATTAATACTGATTCTTTAGTTTCCATTTATGTTATAAACAAAGTACGTGTTTCTATCA
GAAATATAAAAAGTTTTTTTTATAAAAAATGAAACAAAATGTAAAGTTTTTTAAAAATAT
ATTGTTATAAATAATTAAAATTATATTGTTTGTTTAAATTGAAAATAGAAAAGAATATAT
AAATATTTTTCAAAAATGTCTTGGTCTATTAATCTAAGCAGTGTGGGTGATAATTTTAAA
ACTCTAGATGAGATACGAGCGCATGTTAAATCTACAACAGAATCGTGTGATAAAAACAAT
GAAGATATTTTTCCAGAAGATATAGAGATTCCCTCTCCAAAACAAACAAAACAAAAAAGA
ACAACTACACCTCGTAAAACCACGACTGTTAAAACAAAAAAAGACAAAAAACAACTACAG
GAAGAAAAAGAGGAGGAAAAAGAAGATAATGAAAAAACAGAAGAAAATGAGAATATAGAC
GAAGTATTTGAAGAAGAACTTATTATCGAGGAAGAAATAACGGAATGTGAAGAAAAATCG
GAAGATACTACTGAGTTTTCTGATTTAAAGCTTGCAACAGAAACAATTATTAAGATGCTA
AAGTTACTGAATACCAAAGTTACAGCTGTATCCACCGTATTAGAGGATGCGCAAGCTGCA
TCCGTTAATAGACAATATACATCGTTGCTAAAAACAATAGAAAATTTAAAAACATTAGCT
AATAATGGAAAAGCTACCGTATCAAGAAAGAAAGTAAAATCAGCAAAAAAATAATTATTT
AATTCAAAAGGTAATGTCTTATTCGTTAAATAAATGAGAAGATTTTCCTATAAGGATGGG
AAACTTTTTTTCGATAAAGAATTTAAACATATCGTTCCTTATGATAATAAAACATATGAA
ATACTTAGGCATGTAAAAATACCACCGCATTTAACAGATGTTATCATTTATGAACAAAGT
TATGAACAATCGTTGACAGGATTAATTTTTGTAGGTTCTGATTCTAAAGGACGTAGACAA
TATTTTTATGGAAAACTTCACATTAAAAAAAGAAATCATTATCGTAATGAAATATTTATT
CGGGTATATAATATAATTCATGAAATAAATAAATTTATCGATGAAAATATAAAGAAAAAC
TCAGATATAGATTTTCAATCCGCCGTATTTTTGTTAATGGAAACTAGTTTTTTTATACGT
ATAGGTAAGATGTGTTATCATAAAGAAAATGAAACAGTTGGTCTTTTAACGCTAAAAAAT
AAACATGTAACCTCATCAAAAAATAAAATATTAATAAACTTTATGGGTAAAGATAAAGTT
TTTCACGAATTCACCGTTCACAAATCCAATAGATTGTATAAACCACTTTTGAAGCTCATA
AATCAAAATAATCCTGATGAATTTTTATTTAATAAACTTAGCGAAAGGAAAGTATATAAA
ATGATGAATAAATTTAATATTAGATTAAAAGATTTAAGAACGTACGGTGTAAACTATACC
TTTTTATATAATTTTTGGACAAATGTTAAATCATTAAATCCAATTCCATCAACAAAAAAA
CTAATAACCTTATCTATAAAACAAACTGCTGAAATTGTAGGTCATACACCTTCTATTTCT
AAAAGCGCTTATATGGCAAATACAGTAATAGAATTTCTTATTCAAGATTCTGAAATTTTA
AAAATTATAAAAGATATTTCCTTTGATGAATTTATTAAAATGATTGTCGAGTATGTGCGC
AATAGAGAAACAATATAAAAAATATTTAAATAACATAAATGGATAAAAAATTAAACACGA
TATCTCATACATTCTTTTCTGGTGAATTATCGACAATAGATATAATGGTGTTGAAAATTC
ATCTATTAAACATACATCCAAAAGATGTAATATTTTGTACGGACAATAATTCATGCTTTA
TCATAGATTTTAAATATGATGACTGTGTGGCATCTGATTATATAAATAAAAAATTAATTC
CAATTTTGCCCGATAAATATATTGATTTTTCTCCGATGATAGCCGCTGAAATGACAAATT
ATGAGATTATTTTGGACGATATCAAAAAATATATTGAAACGTCAAAAAAATTAAAAAAAG
TAATTAAATTTTATAAATCTAATAAAAAAAATAAATGTATAGAAGAAGCAAATAATAAAC
TTAAGATAGCTATGAAAAAAGGTGTAGATTATGATTATATAAAAGGAACATATGTTTAAT
GAATTACTTAAATGAAAAAAAACTATTTTATATTTGATAGTCTATAATGGATGATAAAAT
TTTTGATAAATCTTTAAATGATTATATAAATGAACTTATTGGTGTGTATGAATCTATTCC
AAAACCAAAATCGCTAGATGATATAAATCATGAGGTAGAGATTGTTTTTATTCAGCCACC
ATTGATAACATTAAATAATGTGTTAAATATTTCATCTAAACAAGAATCATATATATTATT
TTCGTTAACTAATAAGGAAGATAGAGTTAAGATAAGATCTTATTTACCGATGTCAAAAGT
ATATGGCCTCGATTTAAAAAATATTCAACTAGTTGATTCTATAGATAATATTATATGGGA
AAAAAAAACTTTAATTACTGAACATATTGTGGATAAGCATTGTATGGTAAGATATTCTAC
AGAAGAAAAACATATATTTTTAGATTATAGAAAATATATTTCTGCCATACGATTAGAATT
GGTAAATTTGATCCAATTAAAAATAAAAAATATACTTATAGATTTTAAAATTAAATATTT
TCTTGGATCAGGAGCTCAAGCTAAAAGTTCATTGTTGCATGTACTCAATCATCCAAAATC
AAAACCAAATGTTTCACTAGAGTTTGAAATAATATCGGAAAATGATTATAAAATTGATAA
GGATATAATTTTTAATGAGATATCTACATTATTTAGAAACATATTTATGGGCAATCCAAA
AAATATATTCATGACTCCTGAACAAAAAAATCCAATTAAAACACGTATGATAAAAAAACA
AGACCTTACTGGATTAGAGTTGGACAATCTATATATTACTACAAAAACAGATGGTGTTGG
ATCCTTAATAAAGATAAACAAAAATGGGATATTTTGTTATTTTAGTCATCTTAATTACTC
TATACGTTATAATTTGTTAAAGCCTATAGATAAACAAATTGTATTGTATGGTGAAGCTTT
AAAGCATGGAAAAATGTGGAACATCTTTTTAATAAAACTAATAGAACCTATATTGGATGA
TAGAATTAAAGAAAAAGATTTTATAAACGATGAACTTGATAATGTATGTGATAGATTAGA
ATTTAAAGTAAAAAAATATGAAGGTCCATTTACAACACATTCTGAAATAGTTGATTTGTT
ATCATCGTATTTACCTGTACAATCCGAAGGAGCTATATTATTCTATTCTAAAGGAAATAA
ATCTAATATTGATTATAAAATAAAAAATGATAATACAACGGATCACATGGCAAATATAAT
ATATAGATATATGTCTAGCGAACCTGTTATTTTTGGTGAAAATCAAACTTTTATAGAATA
TAAAAAGTTTAGCGATGATAAAGGTTTCCCGAAAGAATTTGGTAATGGAAAGATAGTTTT
ATCGGAGAAAATTAGATATTTGAATAATATTTATTGTATAACATTTGATGACTTATACAA
GGATGTAGGATTACATACGGTTACGGTACCTATAAAATTTATAGCTGAATTTACTACTAA
TGGAGAGTTTATAAAACCAAGACTGGACAAAACAATGAAATATTTTTACAAAAATTATTA
CGGAAACCAATATAATGTGGTTTTAGAGCATTTACACGATCAACATATAAAGATAAATGA
TATTTTTGATGAAAATAAATTATCAAACCTCGGAGAAGAATATGCAAAAGATAAAGATAA
AAACAGATTAAATCCTGAAACTTCTTATTTTACCAATAAGCGAACTAGAGGACCTTTGGG
AATACTTTCAAATTATATAAAAACTCTTTTGATATCATTATATTGTTCTAAAACATTTTT
AGATAATACTAACAAAAGAAAAGTATTGGCAATAGATTTTGGAAATGGTGCGGACCTAGA
AAAATACTTCTATGGAGAAATATCATTATTAGTAGCCTCTGATCCCGACCAAGACGCGAT
AAATAGGTGCATAGAACGGTATAATAAATTAAATTCTGGTATAAAATCAAAATATTATAA
ATTTGATTATATAAAAGAAACGATAAGATCTGAAAAATATGTATCTAATATTAGGGAAGT
ATTCTTTTTTGGAAAGTTTGATATTGTTGACTGGCAATTTGCTATTCACTATTCATTTCA
TCCAAAACATTATTCTACAGTCATGAAAAATTTATCGGAATTAACCGCCTCTGGAGGAAA
GGTATTAATAACAACCATGGATGGTGATAAATTATCTCAATTAACTGCTAAAAAAACTTT
CATAATTCATAAAAATTTACCAAATAGCGAAAACTATATGTCTGTAGAAAAACTTAATGA
TGAAAAAATATTAGTATATAATCCATCATCTATGTCAAAACCCATGGAAGAATATATAAT
AAGAAGAAGTGATATAATACGTATATTCTCAGAATATGGATTTGTGTTAATAGATTATGT
ACATTTTGATACTGTGATTGATAGAAGTAAAAAATTTATCAATTGTGTTTCAAAAATGGA
AGAAAGACAATCCACTAAAAACTTTTTTGAATTAAATAGAGATGCATTAAAATACGAAAA
AATAGATATAGAAAGTTTACTTCAATATTATGTCGTATATGTCTTTTCTAAAAGGTGAAT
AATAATAAGGTAGACTTTTTTTACATAATTCGCCATATTTAAACGAATTAAATAGGTTTA
AAAGAACTGTCTTTAACGATATTATATTGGATGGCATAATTTCATCCAATTTTGGTTTTG
AATTTATAGTTATTGTTTTAGACGGATAAATAGGATTTATTATTTTTTCTATATCATCAT
TAATAAATAATAATTTTAATATCCATTCACTATTTCTATATATAAATTTAGCAATTCCTA
ACATTGTTTTATTATCAAATCTAGAAACAATATTATCATATATGTGGATAGCATTTATTG
TACCATCCAAACTCATTTCCAAAACTATTGTTTCGCTGGAATATATTTTTTCTATATCTA
CATTACATACAATATTAAATTGATGTATAATATTAGTAATTTTCTTAATCTCTTCTAAAT
TCATCATGATAGATTTTAATATTTCTATTATAAACGACGATCGTTTATATCCAAGATTTA
ATAATTATGAAAATAATATATTTTTATTAATAGGTAATCATAATGAGTTTATTAATAATA
TTTTAAAAATAATTAAAAAATATCCAATGTTTTTTTGTGAATATGAAGTATATCCGGACG
AATTAGGCATTCTTAATTTAAATTTATCAAAATCGAGTCATTATATAAAAACTAAACCCG
TTACTGTGGAAGAGTTTATATCTATGGGAAACAATATGGATTGGTGTTCGGAATTGGAAA
TTATAAAAATATTGGATTCATTCGAAAAAATATTAATTTATGATATTGTATATTATAACA
TCTTAAAATGGAAAAGAATATTAGTTATCCAATGTCCTCAAATTAAGAATATACTATATG
AATCTTTTATGACAAATCCTTTCATTGTATCAGAAAATAAAGACATCTTTAATAATTTAA
TTTTATGTTCATCTATTAATTCTATGTTTTATAATATAGATCAATCTTCGTTTAAAAACT
TATTAGATCATATAAATTATACAACCGGTATGAAAGCGATAAATATTATAACAAAAAATA
ATCCAGATACTATAAATATTATAAAATCTTGTTATGATAGAAACAAATTTAGAGCTTTTG
CATATGCTTGGTTTAATTCTCAAATTAATAATAATATATTAGAAAATGAAAAGGTAGAAA
GACAATTTGTAGAATTATACAAACTAATATGAAAAAAATAACAATAAAATATAGACCTTA
TATAATTGAATATCATGAAGATTGGGAAAGCATAATAGACCAATTAGTGGATGGCTATAA
TGAAGTTGCCAAATGGATATTGAAAGATGAAACCTCTCCCATTCCAGAAAACTTTTTTAA
ACAATTATCTGTATCTTTGAAAGATAAAAGAGTTTGCATATGTGGAATAGATCCTTACCC
GCACGATGCTACAGGCGTACCTTTTGAATCACCAAATTTTTCAAAAAAAACAATAAAATC
AATCGCCGCATCCGTTTCTAATATAACTGGAGTGGTACATTATAAAGGATATAATCTAAA
TATTATAGATGGTGTATTTCCTTGGAATTATTATCTAAGTTGTAGAATAGGAGAAACAAA
AAGTCATTCTCTACATTGGAAAAAAATATCCAAAATATTGTTGCAACACATAACCAAATA
TGTAAATGTTTTATATTGTTTGGGAAAAACAGATTTTTCAATCATAAAATCATTATTAGA
TACTCCTGTAACAACAATAATCGGTTATCATCCTGCCGCAAGGGATAAACAATTTGAAAA
AGATAAAGGTTTTGAAATTGTAAATATATTATTAGAATTAAACGATAAACCTGCTATAGA
TTGGTCTCAAGGTTTTAGTTATTAGCTTTAGTGAAATTTTAACTTGGGTGTATTAAATGG
CAAACTCTATCATAAACAATGAACATATATTCGTTCTTAAAACTATAGGTGTACCAGCAT
CGCATAGACATAATGAAGATCCAAGATTTGTTGAGATTTTCACATGTGATGAATTAGAAG
AATATATAAAAAATAATCCCACGTGTACTTTATTTGAAACTTTACGCGATGAAGAAGCAT
ATTCTGTTGTTAGAGTCTTTTTTGATGTTGATTTAGACGCTATTTTGGATGAAATTGATT
ATATTGCGGCATTGGAAGATTTTATCCTAGAAGTTACTAAATTTGTTTCTGTATTTGCAA
CCAAAGAATGTTCATCAAATCAAAATATGATTTTGAAATGTATGCGATCAAATTTTTCAA
TCACAAAATCAAATGATAAAAATAAAACAAGTTTTCATATGATATTTCCAGATACATATA
CTACATTAAATACATTAATGGCGATGAAGAAACCATTGTTAGAATTTTTAAGAGCGTCAG
AAAATCCATTAATAAGGTCTATAGATCCAGCAATTTATAGACGAAAGGCATCGTTAAGAA
TTGTAGGAACAAGAAAAGTTGCTAATAATGATAAAATTCATGTTAAACAGCCACCGCATA
CTGATATATCCGATTATTTATTTACATATGTTAAGATGCATGACAAAAGTTGTTACTTTT
GTTTAACAAAAAGGCTGGAGGATACGATGCCGAATGTATTATGGGAACCAAATTATATAC
AATTTAATGAAGCTATGAAAAAGGTTTCTAAAACTATTATAAATGAAATTGTTAATTTTA
AAGATTTAGATGTAAACAACTTTACAACTGTACCATTAATTATAGACTATGTAATGCCAT
GCGCTTTATGTAAAAAAAGAGCTCATAAACATCACCATCAATTAGCTCTGGGAAATGGCA
TGTTAAAAATATATAAGGCCGGCAATCCGCACAGTTGTAAAGTAAAAACAATAACATTAG
AAGGTAATAAATTATTTACAATAGCACAAATAATTATGGATTCTAATGTAATTCATTTAA
CAGATAGAGGAGATCATATTGTGTGGATAAATAATTCATGGAAATTTAATAGCGAAGAAT
CGCTAATAACAAAACTTATATTAAATATGAAAGATCAACTTCCAATGGAATATGGTCATG
ATGTATTATGTCCCAGAAAAAGAAAGGTTATTGAAAGTAATTTAAGAGACATGTTGGTGG
ATAATATAGAAACGGATACATATCCTTGTATGTTGCCGTTTAAAAATGGTATATTAGATA
TATCAACTGGTAAATTTTATACAGGTCCGGAATCAAAAAAATTTGTGTGTACAGTATCTA
CTGGGTTTAATTTGGATGTAAATATATTCTCAGATGAAAATTCTAAAGAAATGAAAGAGT
TAGAAAAAATATTAAATGACATACAACCATTAACTGAAGAAAATAAGAAAAATAGAGAAT
TATACGAAAGAACATTGGCTAGTTGTTTATGTGGGTCTACAAAACAGTGTCTCACTTTCT
TTTTTGGAGAAACAGCAACTGGGAAATCCACAACAAAACGATTATTACAATCTGCTATAG
GTGATTTATTTATAGAGACAGGGCAAACAATTTTAACGGATGTCATGGATAAAGGACCAA
ATCCCTTTATTGCAAATATGCATTTAAAAAGATCTGTATTTTGTAGCGAGTTACCAGATT
TTGCATGTAGTGGCAGTAAAAAAATAAGAGCTGATAATATAAAAAAATTAACAGAACCAT
GCATTGTGGGTAGGCCGTGTTTCTCAAATAGGATAAATAATAAGAATCATGCCTCCATCA
TTATTGATACCAATTATAAACCAATTTTTGACAAAGTGGATAATGCGCTTATGAGACGCA
TATCTCTTATAAGATTTAGAACACATTTTACACAAAAAAATGGATTTGAGACAGCAAGAA
ATAATTCCGCATATAGTGATATAAAGCAGTTAGATGAGAATCTTGATATAAAAATACAAA
AAAATTATTATAGATATCAATTTTTAAATTTATTAGTAAAATGGTATCAAAAATATCATA
TACCCACAATGAGATTATTCCCAACACCAGATGCGGTTCCTGATTTTGAATTTCAGCTCA
AAGTTACATCATTGATTGTACCGAGTTCAAGCAAACATCTTCCATTAATTTCAAAATTAG
CAAAAATTGGTTATGTGTTAGAAAACGAATTAATAGTTTTACCTTCTCAATTATTTCAAC
AAAAATTAGCTAATCATTTTAATATTAGAGTACATGGTCATGACATAGAAAGTTTTATTA
TGAGACATAAAAAATTTGCAAATATTAGTGAGGAATATTTAGAATATATATTCATAGAAG
ACATAACATCTAAATGAACTTGGGAATAGTAAAATTATTTTCTAATCATGTTAATAATAT
TCCTAATATATTACCTCATCAATTAGCTACACTCGATTACCTCGTTAGAAGAATTATAGA
CGAAAATAGAAGCGTTCTTCTTTTTCATATTATGGGATCTGGAAAAACAATAATAGCTTT
GTTATTTGCATTGGTCGCTTCGAGGTTTAAAAAAGTTTACATATTAGTACCAAATATAAA
TATCTTAAAAATATTTAATTACAGCATGGATGTAGCCATTAATTTATTTAATTCGGAATA
TATATTAGAAAACATATCTATACATTCAACCACAAGTTTTTATTCTCTTAATTATAATGA
TAATGTAATAAATTATAATGGTTTATCCAGATATAATAATGCTATCTTCATCATTGATGA
GGCTCATAATATTTTTGGAAACAATACAGGAGAGCTCATGACGGTAATAAAAAATAAAAA
TAAAATACCATTTTTATTATTATCTGGATCTCCTATAACAAATACACCGATTACATTATC
AAATATCATCAGTTTGATGTCTGATGAAGAAATAAATTTTGGAGATATCATCATACAAGG
TAAAAAGGTCTTTCAGATATTATTAAATGAAAATGGGGTAAATGTTTTAAAAAATATATT
AAAAGGAAGAATTTCATATTATGAAATGCCTGTTACCGATTTACCAATTATACAATATCA
CGGAAGATCATTTTTGGATACAAAAGTTGTATATTGCAACATGACAAAATTGCAAGAGAG
AGATTATATAAATGTGAGAAAACTATGTAATAATGAAATGTTTGAAAAAAATATGAATAA
TGTTTCGTTAGCCGTATTGGGACAATTAAACTTGATAAACAACCTAGATATATTATTTCA
AGAACAAGATAAAGAACTTTATCCCAATTTAAAAATAAGCAATGGGGTATTATATGGAGA
TGAATTAATAAATCTTAATATAAGTTCTAAATTTAAATATTTTATTAATAAGGTTAACAA
TCTTAAAGGAAAACAATTTATTTATTTTTCTAATTCTACGTATGGTGGATTGGTAATTAA
ATATATTATGCTTAGTAATGGATATTCAGAATATAATGGTTCTCAAGGAACAAATCCAAA
ACTTATTAAGGGAAAACCTAAAACATTTGCCATTGTTACAAGTAAAATGAAATCTTCTTT
GGAGGATTTGTTGTCTGTATATAATTCACCATCTAACGATGATGGTAGTCAAATTATGTT
TTTATTTTCATCCAATATTATGTCTGAATCTTATACATTGAAAGAAGTTAGACATATTTG
GTTTATGACTATCCCAGATACATTTTCACAATATAATCAAATATTGGGTAGATCTATACG
TAAATTTTCATATTCAAATATAGATGAACCTGTTAATGTATATTTATTAGCCACAGTATA
TTCAGATTTTAATGATGAAATAACATCGTTGGATGATTATAGTTTGGATGAAATAAATAC
TCTTCCATTTGATATTAAAAAACTCTTATATCTAAAATTTAAAACAAAAGAAACAAATAG
GATTTATTCTATTTTACAAAATATATCTGAAAAATATGATTTACCTCCTCATCCATATAT
AGTTGAAATAGTATTGGGTGAAATTGTTAGACAGTTTTTTTATCATAATTCAAGGATAAA
TATAAAGAATGAAAAACTTATAAACTCCATTAAATCAGTGCTAATCAACACAGATTCTGT
CAAAAGATATATAGATAATATAGTGAACGGACACTTTTTTGTATCCAATAAAGTATTTGA
TAAATCATTATTATATAGGTATAAAGATGATATTATAACGGTACCATTTAAAATTTCCCA
TGAACCATTTATTTGGGGAGTGAATTTTAGGAAAGAATATAATATAGTATCCTCTCCATA
AAATTGAGTAATAAAAATATTGTTATTGACAATGTCAACCTTTGTTAGAAAAGTTTATCT
TCCAATTAGTCTAAATCCGCACGAATTAACTTTAGATATACGTGATAATATAAAGGATTC
TATATACAATGAATATCTACATAAGGAATCTGGAGGAATGATGGCTAAAAAAATTGAAAT
TTGTTTTGATAAAGAATTACCATTGGGTGAAATAATAAATAATAATGTTGTTGTAAAAGT
TCCTTGTATAGTAACATATAAATTTTATAAAAACGGTGATATTGTTAGCGGTACATTAAA
TATAGAAGATGAATCAAATATCACAGTTCAATGTGGTGATTTAATATGCAAGCTTAATAG
AGATTCAGGAAATGTATCTTTTAGTGATTCAAAATATTGTTTTATAAGAAATGGGGTAGC
GTACGACAATGGTGCGCAGATATCTGTTGTATTAAAAGAAGAGCAACAAGGCATGAATTC
TAATTTTGTTTTTTTGGCATCAATTATTGATGAGAATAATAAGTAGTATCAATAAATGAA
AATAAAAGAGATATTACGAGATGTTTCAAAATGTCTTCGACAATTTTCGAAACATCTAGA
GAGATAGTATCAGTAGAAAAAGTAGATGAAATACCAAGATCAAAAAGTATACATGTGTTT
GCTATTTGCATAACTAGTGATAATAAACCAATAATAGCAGCAAGAAGAACTTCTTTTGTA
TTTCAAGAAATAATGTCTCAAAGAAAATCTCCAACATCGACGTTGAAAGTTTCTAAAAAC
TTATTACGATATATGTATAATAACGAGATCAAAGAAATAAGTAGAAGATTAAAAAAAGGT
ATTATATTGATCAATAATATTAATTCTTCATTTGAAGAACTAATTTTATTAGGTGGTAAA
ATTAATAAATCAGAATCTGTAAATGAATGTTTACAACGAGAAATCCAAGAGGAAAGTGAC
TATCATCTTACCATTAAATGTTTTGGTCAAGAATTAATAAAAATATCAATCTATGATAAA
TTATTTGAAAAAAAGTATATAAGTTATTGCAAAATATGTTATATTAATGAAACTCTATCA
ACTATTTTGTCCTTTAAACTATATAACGTCGAAATTAGAGAATTAAAATCATTAATCGAT
TGTTCAAATAACGATAAATATAAATATCTATTTTTTATTTATAATACATTGATTAATAGT
AAATAATGGATAGATATTATTCAAAAATGTTTAATTACATCACTAAAAATAATAGAAAAT
TGTCAAAAACATATATTATATCGGATGACGTTCAAAAAATATTAATTACTGGATTCAATA
ATCAAAAATTATTTAATTCAAACAAAGTATCTATTTGTGCAGTATTATTAACCAGAGACA
ACAAGTTTATTGGTTGTTCGAGGAAAAATAGTTTTTTATATACAGAAATAGTTCGTTCAA
AAAATATGTTTCGAAAAGAAAGATTATTTCTCAAATATACAAAATATTTAAAAAAAATAG
AAAGACAACTATTGTCCTTAGAATTAAATTTAAATATAGCAGATTCAGATGAAGATCACA
ACAATATTATTTTTCCAGGAGGTATTCCAAGGTCAGGAGAAGATCCGCTAGAATGTCTAT
CTAGGGAAATAAAGGAAGAGACTAATATAGATAGTAAAGATATACTTTTGGACTCCAGAT
TTTTTATTCATATGTTTATAGAAGATCTTTTAACAGATAGAATTTATGAAACGATATTAT
TCTTTGGTAAAACTAATTTGACTAGCGAAGATGTTTTGAATAATTTCGTATCAAATAAAG
AAATTAAATCATTAGTTTTTTTAAACAAATTTGATACTGGACTATCTAATGATATCATTC
GATTAGTACTTTCTATTTCTGAATTAAAATGTTTTGGAAACAATGGAAAAATAGAATCAT
TAAAAAATTCTAGTTTAGGATTGTGTGAAATTACATAATACAATGCATCATCTATCTTAA
TCTATTAATAAATATACAAGTTTATCATTATGTATTTTTATTATAGGATTATCAGGCATA
TTTTGTATAAAATTACCATCGGTATCATATATTTTTCCATCTTCCGTTTTAAATCCTCTA
TAAATTGTTATTAGTCTGTTGGAATGGGTATACCATATATTTTGTCCTTCGGCTACATGT
ATTATTTCTCTAGGTTTGCTATTCATATCTATTGCTCTAGAAATTAATGAAGTCCATCCA
GATTCATCATCTATAGGTGAAAAATTTTTGTGATGCTCATAAATCCATTCAATAGAAGAT
TCTTTTAATACTTTAAATAATTGTGTGAATTCTTTGGATTTTGTGCGTATAATGTCTAAT
AAATCTTCATCCACAGTGCTATCACCGTTAGACAGTCTAGCAATTATAAAATGTACATTG
ACATATCGCCGGTCTTCTGGTGTGAATATATGACTGTTTAATCTAATAGCTCTACCTATG
ATTTGTTTTAATGAGGCTTCATTCCATGTCATATCCAAAATAAAAATATCATTGATAGAA
AAAAAGCTAATGCCTTCTCCACCACTTAATGAAAATACACATACTTTAATATGTTCACCA
TTAGTATTACACTCTTCATTGAACTTGGAAACCATTTTTACCCTTGTATCTTTTGTTCTA
GATGAAAATTCTATGCTTGATATTTCAAAAATAGAAAAATATAATAGTAATATTGATATT
CCAGATTGATTTACGAATGGTTCGAACACGAGGCATTTTCCAGGAGATGAAAGTATCCTT
AAACATACATCCGTAAACTTACAGCTTCTTTCTCGCAATTCATTAAAAAGAGATATGTCG
GAAGCTTTAGCTCCCCCATCTAGTTCTTTACCTTGTTTAAACAAATTAATTGCATATTTT
GAAAAAGATCGATCTGTTATCATTTTTTCAAAATCTTTATAAAGAATAGAGATTTCATTA
GAAAATTCCTCTATAGATCTTCCTTGTTTTTCTGGAAAAGAATCAAATGTAAAAGTCGCG
GCCATTCTTCTATGAATTCTAAATGAAGATGTTCCAGATTTTAATTCTGCAATTTTAGCC
TTTGAATATATATTTTCTTGTTTTTTTGTCATATTCACATATCTCATATATACTGTTTTC
TTCGCAAAGGCGTACGAACCTTCTACGTCTTCAAAAATAGAAAATTCATTATTCACAATA
TAGGAACAAATTCCTCCTAATTTATTAATTAATTCTTTCTCGTTTATAAGTTTTTTATTT
TCAAATAATGATTGTGAATTTAAAATTTTTGGTCTAAGAAGATTTACTAACATTGTAAAC
TCTCTTATATTATTAACTATAGGTGTTGCGGATAAACATATCATTTTATGATTATGTAAT
GCTATATTTTTAGATAGGTAATTATAGACAGATTTTGTAGGTCTCTGTTTTCCATCTTCT
TTGACTAAGGATTTAGATATAAAATTATGACATTCATCAATTACAACACATATTCTGCTT
CTAGCACTTATTGTTTTTATATTTGTAAAGAATTTATTGTGAAAATTTTTATCATCATAA
TTAATGAATATACAATCTTTAATTATTTCCGATGCATATTTAGAAATTGTATTCATCCAT
GGATCCTCAATAAGAGCCTTTTTTACTATGATGATGATTGTCCAATTTGTATAAATATCT
TTTAAATGTTTTAATATAAAAATTGTGGTTATTGTTTTACCAACACCAGTTTCGTGAAAT
AATAATAGCGAATGCATTTTATCTAATCCCAAAAAAACTCTAGCAACAAAATGTTGATAC
GGTTGTAATTTTATGACGTTGTTATCCGTTCCCAACATCTCTATATCCATTGTTTCAGTA
TTGCGAAGTGCATAATCAACATACGCAGCGTGGTAGTTACTCATTTATCTATATATTTAA
ATTTAATATTAAGTGATGCCTATAACAAAAGTTTTGTCAGTTTTTTTTGAAACTCATTTT
CAATACTTTTGTTAGGAGAAATCATACTTGAATACAATAAAGAATGAACATAATATAACG
ATTCATAAACAGAAGTTGAAAAATCTAAAAATTTATCTATAAATTCTCTATCCACAGATT
CTTGCAATATTGTAAATTGAACATTATTTGAATCCTTCCAGTTGGATGATTTGGTAACAC
TTCGTATGTGAGACATAAATTCATCCATATTTTTTTTATATACATCCGTAGCAACCATAA
TAGCGCTATCTTTTAACCAACTATCATTTGTACACTTAAACATTTTAACTGATTTAAACA
AGCTGCAATAAACTCTCATTGTATCTATAATACCTCTACCGAACAATGTTGGCATCTTTA
CTATACAATATTTTTCTGATACAAAATCAAACAAAGGTCTAAATACTTCAAATGTTAACA
TTTTATAATCACTTATATATAAATTATTTTCAGTTAAATAATTATTTGATTTTATTAATT
CTCTATCTTTTTTAAAAAGTTTATTTTTAGCACTCAAATCCGCAACAACAGCATCGGCTT
TAATGCTTTTACCGTAAGATTTAACGGATTGTATTTTTAATATGTCGTAAACACTTTCTA
AGTCATTTTCAGGAAGCATCAAATCATGCGTAAACAAGCTTAACAAATCAGTTGGAAATC
TATTTAAATCATTTACTCGTGATAACTGAAGAAAATAATTTGCCCCATATTCCAAACTAG
GTAATGGACTTTTGCCTAAGGATAAATTTAATTCCGGAAGTGATTCATAAAATGGTAGTA
GTGTATATACACCATCCTTTATATTTTTTATTATCGTTTCCATTTATATTTTATAATTCG
ATTTCACTTTATTCATTCCCCCAATATTTTTGTTACATTGATTCCGCTATCATTCGTAAC
CTTATATAAATCATTACATATTAATACGAGTTGTTTTGATATATAATATATAGGATTATT
AGGATCTATAGAGCAAAAAACTACTCTTACAGAAATTTTATCTTTTCCTCTAGATGGGTT
TGCTATAATCGTCGTGGGTTTGAAAAATGTATGCGGAGTAAAATTAAACCTTAACGTTCT
AGTTCCACAGCTACAATTAGATAGTAAATCATTATAAATTTTTGATATCGGTCCTGTTTC
TGAATATAATACATCGTTTCCAAACCTAATTTCTAACCTAGAAATAATATCGGTTTTATT
TTTGAAATCTATTCCTTTAATAAAAGGATCATTTATGAATAAATCTTTATCTTTTGATGC
ATCTGATCTATTGTCACCACTGTATACATTTCTTTGACAAGACCACAAATTTACAGGAAT
TGATACATCTGTAATATTCACAGAATGTGAAATTTGAGAAAACATAATTCTTCTTGTGGA
CTCGCTATACGTACCTGTAATTGCCGAAAATTTTTTTGAAATGTTATACACGACTGAATT
TTTTCTCGTTCCAAAAATTAATATGTTTGTATGCAAATATACAGACATATTACACGGAAC
ATTATCAATTTTAACGAAAACGTCTACATCTTGAATAGTGACAATACCATTTTCAGGCAC
CTCAACAATTTCCGACGTTTCTGGAAAATTCTTTGGAGGTCCGTCACTAACAATAACTAA
ATCTTCTAATAACCTTTCAACAAAAGAACAAATGTAGTCTCTCTCTGTTTGGGCATAACC
CGGATAAGCTATAAACTTATTATCCGCATTTCCATAATACGGTTTAACGTACACAGAAAG
TGACGTAATGGCATGAACTTCAGATACGACAACAGTGGATTGATTTATTTGACCTAATAT
TCTTCTAGGTTTTTCAATATATGTTGGTTTTATATTAATATTTTTTACCATATAGCCAAT
AAAACTTAATTCAGATACATATACAAAATCTTTTATAAATGATTCATAATTAAAAGTGGA
ATCTCTAATTATAATATCAGATACCGGATTAAATGTTACAGTAACAACTATTTTTGAATC
GGCTAATTTTAAACTACTAAATGTTCTTTCTACATCAAATGGCGTCTTTATATACACATG
AACGGTTGTGGATTCTTTAATTGTATCATTAGGAGTAAGTCCTGTAGAAATATCATTTAA
TTCATGACTATATCCGGAATTTATTAATGCGGTTTCATTATCTATACAAGAATTGAATAA
ATCTTCACCTGTCGATTCCCATATAACTCCATTGGATGAGGAAATAGATATTTGCTGAAT
GCACTTATAACCTACATATGTAACATATCCAAATCTACCTATACCTTTTACTTCCGGTAA
TTCAATACTTAATATTAAATGACTAAGTGCGGTTATATATTGATCTCTTATTTCAAATGT
AGATATAACTTGTTGATCGCAACTATTATTTCCCGACATTATCCCATTTATTGTTATATA
TTGCGGCATATATAGCGTAGGATTCTGAATATCAACACCAAATACATTGTGTCTTTTTAT
ATAATCGTCGTTACCAATTAATGAATTAATTACAGTGTTATTCATCTTAGACTATTTAAA
GTATATAAGGTTTATAATAAACTACGCAAAGAAATATGAACTGTCTGGTCGTTTTCTTTA
TAAAAGCAATTACCATATATCCCTTCTTTATTTTTTAAAAGATTTATTATATTAATAATT
TCATCTGGCTTATCATAGAATACTAATGGTAATAATGTTATTTTTGGTTCTTCCCTTAAC
GCTACATGCGATTTTATCATAGTAGCGAACGAATCTCTACATATTTTTGAACAAAAATTT
CCAACATATTTACCTTTCATAGTTTCTACATGGAATGGAGTTACTAATAATAATTGATTA
CAAAACCAACAATATGAATTATCAGAATTAATATGTATATTAATGTCGGCTACAGAATTA
TAATATTTAGGTAGTATGCATGTAAGAGCATCGTCGTTTATAGTTGGTTTAGATACAGCT
TTAGGATTTGATATAACAATATCCTGAAGAGATAAACGCTTTGCCATTTAACTATATATA
TATTTTTTATAGCAAATTATTATACTTCTAATGAACACGATACAAATTTTTCATCGGCAA
ATACATAATCATGACCGTAGTCAACAATAATTGATGCCTTTTTTTTATTTCTCATATAGG
ATAAAAAGTTTTCCCATATTAGTTGATTACTATTATTTTTTGTATAATTTTTAACTGTTT
GAGGCTTTAAATTTTTAGTGACATTTGTGATATCAAATATTTTATCAAGAAAAAATGAGT
AATTTATAGTTTTTGAAGGCGTATTTTCCTGACAAAAAAATACTAAATGCTTAAATATCT
CAACTACCTCGTTTATTTTCTCTGTTGTTAGATTTAACTTTTCTTCCTTTACCTGGTTTA
TTATTTCAAAAACTAATTTATAATCTTTCTTATTAATTCTTTCATGCGCCTTTAAAAAAC
TAGATACAAAATTAGCATCAACATCTGTGGCGGAAATTTGATTTTTATTCATCAACTCCA
ATAATTCTGTAATAATTTCCCCGGAACATTGATTAGACAATAATCTTCTTAAAACATTTC
TTAGATGGATAAGTTTATTAGAAACATGAAAATTAGATTTTTTTTGAATTTTAGAACATT
TTTGAAATATAGATTCACAAAAGATGCAAAATTCATATCCTTGCTCGGAGACAATTCCGT
TATGACAACACCCGCTACATAGTTTTAAATTCATGTTAAAACTCTTTTAATTTCATCATC
TAATATTTTATATATGAACTCTTTATTTCTACACGCAGAAAGGAACTCTTTTAATATTCT
TAACTTATTTGGTTGTGATTCCAAAACCATCTTTATAGTTTCAGAATCTTCTGAAAGAAA
TTCAAATAGATTAGCTAAACATCTAGAACACCTTCTTGGTGGATTTAAATTAATATGATA
TTTATCGTACCAGGAGGTCATTTATTAATTAAATATATTTTTTAGAATAATTCAGTTATA
TTCTTCGCGGTGATATATGGTTCGTAATCTTGAGCATAAATCAATATGCAACATTGTCTA
GAAATTAGCGACATGGCTTCTTCCATTTTTAACAAATCATCATCAAATGTTGTGATGTGA
TTCATTAACATTTGCTGTTTTGCCATAGCATAGGATGCACCTTCACCTTTTAACCATTCA
TAAAATTCTGTTTCATCATATTGATTACTTACTTTTCTGTATTGATTTTTTAATGCACGC
ATCATTCTCGCATCTCTTGATGATTTATTAAAGATAGATAATGGATCGTACATCCAAGGA
CCTACTTCTGTAAATAAAATAGTATAATGACCTTTCAAAAATATATCTGTGCTATTACAT
GAGTCAAAAAATTGATCTCCTATTTTATAACATACCGCCGATTTTAATCGATACATTATT
CCATTAATAAGGATTTCTTGAGCAACGTCAATAGGAGAATCATTAATTATAGATCTATAT
CCTGTATAACATTCTCCACCAAATGTATTTTTATGTTGTCTACGTTCAATGTAAAACATC
AATACACCGTTTACAATTACCGGTGAATTTACATTGGGACGACCTGAATTTATTCCATAC
GTTGGAAATGGGTATTCCATTTGTGAATTATTGTATACTCCATATCCTATATTGGGCGGA
GCAAACACTACTTTTCCGGAACTCCCATCATATGTCAACGAATTTATGTTTCCAGAATTT
ATAGCTATGGGACAATTAGATGTTGTTATCATTTTCATAGGATTTATGACTATATAAGGG
ACAGATTGTAATTGCATTTCATAATTATTTAACAACCCAGGTTTAGGAATAGACACTAAC
GCAGGCTTAAATCCCACGATTGAAAGAATAGATGCAAGCATTTGTTCTTCGTCCGTCATT
ACCTGCGAGCAATTAGTATGTATTATCTTCATTAAAAATGGATCTACAGCCTCATCATCC
TTTGAATAAAAAATACCCATTCTCAATTTCATAATTAATTTCCTAATCATAGTATGAATA
TGCGCACGTTGAATTTCTGTAGATATAACATCTGTTATTCCTGTAAATACAATAGGGGAT
TCTTCAGTAAGTCTGTTTATTAAAAGCATATAATTGTCGGCTTTAACTTTTTTAAAATCA
TAAAGTTGCTGAAGCAGACTATGACTATCTCCGTATACAAACGTATTTTCTAGAGCGGCC
AATTTTATACCAAATAATGCCATAAAAATAGGATGTATGTAATACGTAGAATCATTGTCT
CTATAATGAAATGATAGATCCATAGAACTAGACATATCAATAAAATGAATTGACTGAAAT
CTAGTAGTGGATAATAATATTTCATGACCAGATGGAGTATAGAGTTTGTCTAGTTCTCTA
AGCTGTTCTCCAATTCTTGGGTGTGCGTGCGAATGTATCAAAACAAGAGGATGTGTACTT
TTTACGGACATACTTGAGCTAGACAACGAACTTTTTACATGGGATAACAGTTCAAATAAT
TCATTTCTATTTGATCTCATTATGTTTAATTTTCTCATTATATTTAACATATCCTGTATA
GTAAAGCTAGATATATTGCAATTGTTTTCAGTTAAATATCTAGCAATAGTATCACCATCC
TTTCTAAGACGAAGATGCCAATCATGAGTTGAAGCAACTTCATCTATAGGAACCATCTGA
ACAGTTTCAGGTTTTTTAATCGGACATTTATCATCTTTTTCCTTAGGTATTATTTTTCTT
TTCATAGGTCTTTGTCTAACTCCAGCTGTAACCACATCATCTGTAGAAAAATTAGAAAGA
GAATTGCATATAATACATGACATAGATGGTATTGCTGTATGTATATGGTTATTGTTAATT
AATGAAAGAAACTGATTATTATATCCAACATCCAAATTAAGTTTAGAAATTAGAAATGCA
TCGTCTTTATTAGATTCCATTTATATTCGTAGTTTTTACTTTTACACGCAATAATATTAC
TAGTTTTTAAGTAATATTTATTCACCGTCCAAATTACCAAGTTGAAATTTTTTACTTAAT
TCTTTCATTATAGCATTTATAGCATCCATAGTGTTATCTCTAGTAGTCGCTATATCTTGT
ACTAAGTTATCCGCCTCGTTTTGTAAAGATGTTGTTCTATCTTTTATATCCTCACATTCC
CTTATTATTTCCTCCCTGGATATAGAAGAATTACTATTGTCCATATTGGGAGAATTTACA
TCGGAAGATTGTGGCGAGGCTGGTATTCTTATATTTGTAACTTTAAGAATTTTTTTTTCC
TCTAGTTGTTCAACAATCATTTTTTGATATAATTTTTCTCTGCTTTTTAACATTGTATCC
ACATCAGAAATTTGTGCGGAAGAATCATTTGGTTTTATTGTCGAAATCTCATCATCTCTT
CTGTTTCTTGAGGTAGATGCAAGTTCCTTGGCATATTTCGCCATAAAGTCCATTTAAAAA
ACTTTAAAATTGAATTGAGATAATAATTATAAATGGCAGATACTGACGATATTATTGATT
ATGAATCCGAAGATGATATGAGTGAATATGAAGAGGAGGAGGATGATGAAGATAATGAAA
CAAAATCATTAGAAAGTAGTGATGTTATTTCACTTAAACAGTCAAACTATAAAGCTGAAT
TGTCTACGAATTTAGAAGAAGAAGTTCCACAACCTGGCCAATCATCTAAAAATGTGAATT
CTAAAATATTGGCTATAAAAAAAAGATATACAAGAAGAATAAGCCTATTAGAGATAACAG
GTATTATAGCGGAAAGTTATAATTTGCTACAAAGAGGAAGACTGCCTCTGATATCCAATT
TATCCGATGAAACAATGAAACAAAAGATTTTACATATCGTAATTCAAGAAATAGAGGAAG
GTACTTGTCCCATAATAATAGAGAAAAATGGCGAACTATTATCTACAAATGATTTTGATA
AAACGGGTCTAAAAAATCATCTTGACTATATTATTAGTATTTGGAAAAATCAAAATAGAT
ATTAGTTTTAAAATTTATTAAAAAATCTGTCCTTTGTAAGACCTATTAGATGTCTCATAT
CAACAGATTTTCCATCGTGCTCTATTTGATTTTCATTAGATATTGTTTGTAAAATGTCTA
TAATAGTATCTTCTCTTTTTATATATTCTTCAGATATTATGGATTTGTAGGATGTTTTAT
TATCCGCTATGAATCTAATTAGAGTTTGTAAATTGTGAACACCCTTTTTACGTATATCAT
CTATAGATATTTTTGATTTTATTGAATCTAGTACATCCGTCAAAAGATATCCGACTATGG
GATTGGTCTTAAATTGTTGGTGAATTAAAACATATAATTTAGATACAATATGAACAAATT
TTTGAGAGTTTAAATCATTATTTTGAAATAGAATAACAGTTCCTAATATTTTTTTGAAAA
AAGAAATATATTTATTATTATTATCTAAGTTAATTGTTGGTATATCTAAATCTGAAATAC
ATCGTATGCCGTGTATTATACTTTCTGTAGAAATAGTAAATATTTCTCTATACTCCGTCA
ACTTATCTTTATCCGTGATAAGTTTTGAATCAAATATGGCTATAATTTTTAATAGATAAT
TTTGATCAGATAAAATTTTATTAATTGTTTTTACTATAAACGTATGATTATTTTGTAACA
ATTTATATGCGTTACTCTCACACGTTGTATTTTTAAATTGGTTTACTAACTCTATAATTT
TTCTTGAATCTGATACAATATCTGCGGTATCTTGTTTTATACTACTATACATATTGTTTA
TAGAAATAAGAGTTTGAACATTTAACAAAATATCCTTGAATATTGTTTTAAATTTGGTTC
GTTCTTCGTCCGTCTCTAGTTTATTATATACAGATTTTACGACAGCTCCCGATTTAAAAA
ACCAAAATGAAAAAAGCTTGTAATTGCAGTATCTCATCATCAATAAAATATTTTCATCTG
TAATTAGCGGAGTAATTACACATACCTTTTTTTCTAAAATTGGTACCAAGTTTATAAAAA
TAGATACATCCGATTCAAAATTTGGAGGGGATGTAAGAGTTTGTGTTTCCTTTTCCAAAT
ACTGTTTACTAACATTATAGAATTCATCATATAAGATTTTTAGTTTATCCATTATTTAAT
GTAAAATATAATTTTTAATTAATTATGTTGATTCTTACCATTATTAGGATAATATTTTTC
TAATTTCTGTATCACGTTAGAATCTATATCAATATCTATACCTAAATTTAACATAATATT
TATTATCCATGTCTTTATAAATCTTTCTTTAGATTCAGTAACAACATATTTAAATAATGG
AGAAAAATATTTAGTTATAGATGGCACCGTGGTTATATTTTTTGTAAACGTAACATAATT
GGAAGATAAAACACTATCAAATTTTATACCATCTATAAAAAACCCATCTGTAGTAAGCTC
CATTCCTGAATCGGAGCGTATAGATTTAGAATTTAGTTGTTTAGGAAATAATTGTTTAAT
AACATTATAATTTGGAGGACATATATCTATATTATCTTTATCGAGTGTTTTTTTCACAAT
AACAACTTCGTGAACTATTTCTTGTATCAATATATGCACTTTTTTGCCTATATCATAATA
ATTCATTGGAAAATATATAATATCTTCCGCGATTAGCATATTTTTGTCTGTGTTAACAAA
TTCTATAATATCTGATACTGTTCTTAACCTAATTATGTTGTCATCGTCGTAAGATTTTAC
TACATGATATCCGGATGTTTCTTTTAATCTTTTATTATCCTGTTCAAATATTATTTTCAT
ACCTTCATTAAAAAATGTATCAAAAATTATAGGCAAAAAAGATATTTTTGATTTCGTTAC
AACTTTTCCAAAATTAAGAATATAAGGATTTATCACATCTTTAATTACATCTTTATTATG
AACACAAGAAGAAAATGTTTCTGTGTGAGATTGATCCTTCAAAAAACAACAAGGAATACA
AATTTTTTGTAATCTATGAAATATGGATAGAAATCCAATGTTATTATATTTTCCAAGAGG
ATCCAAACATGAAAACATAACACCGTTTGAGTTAATAAATACTTCTTTTGAATCAGATTT
ATAAAAATTTTCACTTATCTTTTTCATATCAAAATCTAATGATGAAATAATTATAGGTTT
TCTATGCTTGTTTTTTGTATTCTGACATATTCTGGACCAATAAACAGTTTCAACTTTTGT
AAAATCCGATGATTGTTGTACATTATTAAACATGTTATTAATAGCAATAACTAAAAATGT
AAAATATTTTTCTATGTTAGGTATATAATTTTTTACCTTTATAGAAATGTGATTTTTTGC
TAATATAATTGAAATACGTTTATCTGCAGATAATAAAATGTTATTTGTGGCTGTTTCTAC
AAAAATAAAACTCGTTTCTATATCTAACTTTATTCTAGATGTAATTGGAGTTGATAAAAA
TATTTTATATGTTACATCTCCTTTAATTCGTTCCATCTGTACATCTATATCCGACAATAA
ACTTGTAAATAATTTAACGTCGTTAATCATAATTGTGTCTCCATCGCTCGAAAATGCTAA
ATTTTCTTCCGCATCCCATACAGATAAGTTAAGTTTTTCATCTGTTATTATAAATTTATT
TCCTGTCATATTAATAAAATATTCATCGGATTTATATAATATAGTTCTGTAATTTAGTTT
TCCATTCAGCTGGTTAATTTTTTTAATTATGTTATTCAGACCGGTAAATTTTAAATTTGT
TCTAAATATATTATTAAACTTGGATTCGACAGTCATTTCTAAATCTAAATTTGTGAATAC
CTCCAATAGTCTAGATTCAAACTTTAAAATATTATTATCAACATCTTCATAAGATCCAAA
TTCTGGAATAGAAGTATCCATTGCATCCGCCACCCATATAACTAAAAAGTTACATGATTC
AGGATATATATTATATAGAAACCCATCTGACTTTATTAATGTTTTTTTCTGAGTATGCAC
AAAGGGATTAAAAATTGTATTGTCTACGTAACTAAATTCTAGATTATTTTTATGAGAATA
TAATAGTATATCATTATTGATGTCTAATAAATTACATATATATCCTTTTAATTGTCTTAT
CTTTAATGTCAACAATATATGCCTTTTATGTATTTCGGGGTTAGTTATTTTTAAATGCGT
AGATAGAAAATAATAAATAGATGAACTTTCATCTAATTCGCCATAAGGAGTCAAATATAG
TGCCCTTTTTATTTCCTGGCCTTTCCCAACATATAATACTAATTGCGGACTGACTATATA
CTTCATTTTTGTATATTTATTACTCTATAAAGTGAAAATCTATACGTTCACATAAACTTT
AACATATGTTCGATCCAGTACCCGATCTCAATTTAGAAGCAAATATAGAAATTGGTGATG
TGAATGTGGAAAATACAAAATCTAATATAGGCGAATCGCCATCATATATATCTAGGAGCA
AAAGATTATATATCCACAAAACAAAAGATGAAGAACGTAGATTGTCTCTTAGATTCTTCT
TACCTAGAATTTACTTCTTATCATATAAAGAAGTTAATTATTTATTTAGATGTATAGATG
CAATAAAAGATGTTTGTATAACTAAAAAAAACAATGTGATCGTTGCTCCGTATATGATTT
TATTGATAATGTCATCAAAAGGATATAAATTAACCGAATCAATGATTGAATTATTTTTTC
CAGAATTATATAACGAAAATAGCAAAAAATTTAAATTTAGTTCACAAGTATGTATAATAC
AAGAGAAATTGGGATACCCTGTAGAGCATTATCATAAATATGATTTTGAAGTATATTACT
CAACAATAGCATTATCTATACGTAAGGTAGATGAAACGGATGAATCTGAGTCCGAAATAT
TTAATACTAGACAAGAATCTGAATTTGTAAGTTCATTGTCTGAAATAACATATAGATTTT
ATATTATATTATTAATGAATAATATGGTTCAATGGAGTTCAAGTACCGCATCTATTATTA
ATCAGATGGTTAATACGGTGTTAATAACAGTATATGAATTAATAAAAAAATGTAACGACG
AACCAACAACATCTATACATTGTAAATTGTCTAATGAATCAAATATACCAGTTATATTAT
TACTTAATCGCATAAATTTGCTAGAAAAATTCATAGTTGGTTTACAATCAACAAAATCAT
TCAAAATAAGTAAAAGAGACAAAGAATTATTATTAAATTACTTTTACTAATGACTTGTTA
TTGTGTATCAGTCGCTGTATTAGCATCCGTATTATTAGATATAGTTAACAATATAATTCC
CAATATTAAAAACATTACCATGCTTACCAAGGATCTTACTATAACAAACCAAAATGAATT
GGGTCTAAACTTATTTTCACAAAAATACATAAAAATATGTCTAAACATATCTATTGCACC
ATTAGCGACTTGAAATAAGGCTAATCCTCCAATAGATTTTAGAATCGCTACATAACATGA
CATTTATTCTGTATCAAAAGAGATTAAATTTCCATCCGTCATATTAAGATTTTTTTTCAT
GAAGTCAAAATATGCTTTGCTCATTTCTGTATAATAATTAGTCATCGTCATTATTTTTGG
CTTTATTATCTCATAAGATTTTCTAATTTCTTCCGGTCCTATTTCTACATCATCGATGGT
TCTTCCATTTCTTTTGATAATGTAAAGAATAGCTTTTAAAGTCTCTATAGAAATCAAATC
TTTATACAGTGAATATGATAAATTAGAGAATAATTTTAATTTTTCTAATAAATCAACTTT
AACTTCGTCGCTAAGTTTAGCATTAAATATCCTTTCGATTGTATATATTGATTTAGCTAA
ACTTTTAAAAATAGATGCCATCTGACAAGATGCTTGTTTTATATCGTTGAGTTGTTTTTG
TGAATGTGCCGTAACAGAATTAAATGTTTGTGATACGAGAGATGTATTTCTTTTCGTATA
TGTTTCTTTCAATGCTGTATTAATCATTTCTGTTATGTCGCTTGTAGAATCGCATTCATC
TGTATCATTTGATATATTGTCAATTAATTCATTGATTGAAACGCTGCATGGAGCCCCTGC
AACAGTAACAAGCTTATCTAAAATATTTAACGGCATTGTTTGTGTGATCGAATCCCCAGA
CAGCTGATTATTCTTTATAAGACTAGATAAATTATTTTTAAACACTATATTCTCTGGACC
AAATGCATCTACTTGCATCATTTCATCGGTTGTGCAAGCTGAAAAGATACCTCTAATATC
TATTCTATCCAATATATTCATCGGTTCCGCGATATGTATAAGTGTTTCCTCATTATTTTC
TAGCATAGAGGTTGCGTCGGTCGCTCCCGCATTAAAATCATCATCAAAATTTTTATTAAT
CATATCTCCTCCATAAAAGAAATAATTTGGAAAAAAATTTCTAGTATAATAATAATTTTG
ATAGCTTTTATAGTCTCCAGCGGATACCATAAAATGTAGTAAATCATATGCAGCGGATAT
TAATTTTTCTGCTTCTTCTTTACTACAACTTGCTTTTATTAACATATTATATATATATTG
TCTGTTAATTCTTGGTCTAACTGTAATTACCGTATGATTATTACTTCCAATAATTGACTT
TCTAACATTTACTTTAAAACCCATTGATGAGAATAGAAGAATGGTGAAATCTTGATATGA
TTCCTTTTTTATTAAATGTGGAGATCCATTGTCATCAAGTTTAAACCCTATATATAGCAT
CAATACCTCTTTTATTGCATGTTCCGGGGATGGATTAGTTATCAATCTTAAAAGTTGAAA
GAATCTCATAAAATTATTTTCTGATAAACCTATGTGCATTAACTTAGATGCAGGCTTTTT
AGGAAACTCTTTTTTTGACATTGTATTTATACTTTCCAATATTTCAGAAATTAATTTTGT
TACCGTTTTGCCCGCCACTACTCTTGGAAGTAAACATACACGAATAGGTATTTCATTATT
CGCAATCACATCCGTAAGCATTGAACAATATGTGGTATTGTTTTTATTAAAAAGTCCAAA
TACATAGCAAGTTGAATTATAAAAAATTATATCGGAGATTTTTTTTGACTTATATTCTTG
ATAATCAATTCCATCCCAAAATAATGATAATTTTGATTTTAATTTTTGTGATCTAGCATC
TTTTGCCAATAAATTCAATAACGTAATAAAATAGTTTTGTCTAGATGATATATCAACAAA
TGTTATATTTAGATTTAGATTTGACACGATAACATTTCCTGTAGTTTGGTCTCTAGTTGT
TATATCTGCCTGGTTATATGTTTGTAAATCTGGATATAAATTTAACAATTTTGGTATTTG
ATCTTGAAATCTCATAGATGCTGCTATGCTTACTATGTCTGGCCTGCTATCAATAATTAA
ATCACCGTTATACGTAATTTCAGAAAGTGTATAATGAGTTGAAAAGTATTGATAATACAA
TAAAAGATGTTTTATAGATAATGTAATTAAATCATTGGAAGCAGGTAGGTTTTGGGGTAA
TGGAATATTATGATCTGTAGATGCTGATTGCATTTGAAAATCTCTATCAAACCTAGGAAT
AGATGCTTGGTTTAATAAATTTCTTATTCCCAATAGATTTTCAAAATCTCTATACAACAT
TATACCATTAGCCTTCCTTACTCTAAAACCTTGTATAGTGCTAGCTATAACATCTTGATA
TAAAAGATTCAACAAATAAGTATTTTCAAAATTTAGATCAGGATATAGAATATTTTGATA
TAATATATCAAATCCGCTATTATCTGGTTTTACATATCCTCCTATAAATCTAGTTTTATA
TTCTGGTTTTTTCAATCGGTACATAACTAATTCTTTTGTAAATCTAGGCAAATCATTAAA
ACTATGAGTATTATTTATAGGATTATTTGAGGCATCTGATCGTGTAGAAAGATTTATAGA
GTTTATATAACCAGGATATATTACGCTATTAAATAATTTAGTACTAGAATACATATCAAG
TAAATAATTTATTCCTAACTTTTCAATAGATATTTGAACATCTTCTATATTAGCTGGTTT
ACCATATTCAGGATTAAGTAGGGCATCGAAAGGATGAACGTACGAAAATTTCAAATCCTC
ATCAATTTTATAATCTAAACATATGGATGGAAGAATTGTAGAAACTATCTTAAATATATA
TTCTGAGTCTTCTAATTGGTCCAAAGTTGTAACTGCATTAATAGGCATCATTTATTTAGT
ATTAAATGACGACAGTACCTGTAACGGATATTGCAAATGATTATGTTGTTACGACGACAT
TTTCAGAAGATGGATATCCGTCGAATAAAAATTATGAAATTACGACGGGTCAACTTTCAA
TATTAAGAACGGTTAATGATAAATTATTGGCTAAAGCAACGTCTCCTTTGATAACAGATA
TAGATAATTTTTCCTCTCCAGAAATATTTATTCCGGGAGAAGATTCTCCCGTTACAATCA
TTGAACATATGGCTTCTCCACAAACAAAATTTATTGATAATGGTTCAAATTTTAAATACC
CTGAAATAATATTAGCAGAACAACAACGACAACAACGAGTAAATATAAAAATGTCTGGAC
TAGAAACAGTTGTAGAAAAGGAACCTATAGAAACAACAAAAATAACATCAATGCCATCCC
ATACTCCTTCTTTAAGTACAATGTTTGATAAAGATAAAAGGATAAAATTATTAGAAGAAG
AAGTATTGGAATTAAAAAATCAACAAAATAAAAGTAATTCTAATTTAGATAATTTTACAA
AACTATTATTTGGTAAAAATTTAAGTAAATCTGTTGAAATTAATAAACGAATTGCTATAG
TTAATTATGCAAGTTTGACAAAATCCGATTTAACATTAGAGGATTTGGAAATTTGTTCAG
AAGAAGAAATAGATAAAATCTATAAAGTTGTTAAACAATATAATGAAAACTACAAAAAGA
GAATAATAATAACTCATTTTATCACTATAGTAATAATTATAATAGAACAGTTATTAGTTA
AATTAGGTTTTGAGGAAATGAAAGGTTTGAGTACCGAATTATCTTCTGAAATAATCGAAT
TAAACATAGGAGAAGATTGTGAAGCAATAGCTACAAAAATAGGAATTGTTAATAGCCCAA
TTTTAAATATTATAATGTTTTTGATAAAGAAATTTGTATCTAGAATTAAAATATGTTAAT
AACTAATCCATTCCAAAATCGTGTCCATCTTCAATATTATTAATGGTTTCTATTTTATGC
ATTCCACCCTTCATTGTTGTTTTTTTAGAAGTTGACCTCGATTTATTAGTCTTTTTCCCT
GCATTAACTGATTCTATACCCAATAAATCTTGATTAATCTCTCCAACCATTCCCTGAACT
TCTAATTTTCCTTCCTTTATTGTTCCATATACAATCTTTCCACCATTTGTTACCGCTTGC
ATTATCTGTGTTTGTTCATTATTCCCGAATATATTTCTCTTTCTTACAGGTGCACCGGAT
GATCTGGAAGAACTCATACGCGTGGAATTGGATGAAGATGGTTGTTTAGTTTTAGACAAA
GATGACATTTTTTTATTTCGTTGTTTCACTGTACATGTTGCTCCGGCCTTTACTTGAACA
TCTTCTATATTATTTTCAATAGATGAATGAGATCTATGATTTGCTTGTTCGCCACTTATA
TGAGATAATATCGTTCTTAATTGTGGCGTGAGTTTATTTATTGTTTCAATATAATCATCA
TAACTACTGCGAGAAAGTTTTTTATTGTCCGCCATTTAAAAGATGAGATAAAAATGCTGT
AAATACTTTTAAATTATTTATATATGTGTATATTTTTTTTATTTACCGGCGCTAATGAAA
AGTTTATAAAAGGAATTTAAATGTCCAGGATTAAGTTTATCAATAAAACCAGTTTTTAAC
TGATCCTGTTTTTCATACTTTTCAGGTATATCAGTGGGAGGGTTCGTTTGTAAATAACTA
GTCTTTCTATTATAAATACCGTATACAATCAATCCAATGATTGCTACACAGATAATAATC
AAAATAAAATCACCAATCATTTATTGACTATTAAAGTTATGTTATCGACAAATATAATAA
TCTAGTATTTGTTAAATTCTAATATAAAAGGTGAATGAATAACTTTATTGTGGATTAAGT
TCTATTTGGCTGGAATTGTATCTACCATCTATAACAATTTTACTGGGTGTACAATATCTC
CCCCACATTGAATATATCAATATACCTATAGTCATTACAATACCTAAAACAAAGGCAATT
CCACTAAGAGCTCGCCAAGTGGTAACTGTCGCTTTATGTTTTGAAAAATCTACAAATGCA
AATATACAAGATGCTGATAATAATATTATACCTCCAATCAATGCTCCACTAAAGTAGTTG
TTAAGATTACCCATTATGTCCATTTAACTAATAAAAATTTTAAAACACTGAATGTATAAA
GTGGAATGTAAACCACATAAATAATATAGATTGCAAGAAGAATACAATATCAAGTTTTAT
TTTTGATGATAATTTTATGTTAGCTAATGAAGCTATACATATTATTCCTATTAAAATAAG
AGGTTCGTAATTAGTTATCATTTACAAGTCTAAAAGGTGGCGGTTTATTCCTAGTAAACA
AAATAAGGATATTACCTTTCCAGCTATTCCTCTTTATATAAACACATATCATAAGCAACG
ATATATATGAAGGGTTAATTAATAATATTTTTTTAAATGAATTACTTATTTTAATTTTAT
CGTCATCGAATGTATAAGAATTTGAATTTGGAAATGGAATATATTTATTATCAGTATTAA
TCAGACAATATGGCCAATTTTTATATATGATTAATGTATCATTTTCTACGAACATTTATA
ATCCTTGTTTTAATTCTTTTTTGATTATATACGATTACAAAATAAAAAATAACTGCCAAT
GAAATAAATACAATAGGAAATCCAAAGAGTATAAACGACTGGTTTCTATCATTTTTTGAT
TTATTTTCTTTAGGTATTCCAGGATCTATATCTCCAATTATTGTCCTATTACCATAACAG
TCTGCTAATAAGTCAGCGGTTGCGTTTTCCAGCGTTAACGAATTAATATTTATATTGCAT
CCTGTATACTTGCATCTAGATCTTTGAACATCTTGATCGTATAATAACCATTTTCTATCT
CTTGTTTCGTCGGTACATTCGTGTAGCCAACAAACTCTAGGTCCTAAATATTTTTCAAGT
GTTATATTTCCATTAGGAGGATACACACACCAACAATTTCTATTTCCTCTATGTTTGTTA
CAAAAATTTATAAGTGCGCTATCTCCAAATGTGTAATAGTCTGGTCTAACAACTCTAATA
AATTCTGAACAATATCGTTGATCCATATCGTCAGAACATATGTTTGAATATGTTTCCAGA
GCTATTTTTCTTTTTGTACGTAGCCATTTTAAGCAATTAGAATTTCCAGGATTTTTTTTA
CAAAACTCAGACATAATTATATCGCAATTAGATGTATTATATTCATTGTTAAGAATTTTT
GGACAATCATTAGTTGGATTAGTACAACAATCGTGTGATTTTTTATCCATTACCATAAAA
TCTTTTTTTATAAATTTGCATTGATTCCCTTTTGATATATAAGCTCTCGCAGATTCGGGA
ATTTTATTATCTATATAATCTTCAGTTATGGTTTTTGTATATTCTATCATTGAACCAGGC
CTAAAATTAAACGATCTACATGGATTTCCATTCACCAATACATATTTTTTTGCTAATTCA
TCGGATAAGAATGTGCCGCAATGAGCTATGTCTACATTATCTGTTAGGCAAAATTTTGGT
GTTATTTCGTTTTCTTCCTTATTGTACTTATCTAAATCCTCATAAAATGTAACTATTGTA
TCATATTCTGGATAATTAAAATTTATAAACATATATTTTTGATTATAATTAACAGGATCT
TGTGAAACTTTTAATCCTGTAACAGATACGGATGAACCCATATTATTTAGAATATTTAAT
TAATAATTTTAATCTTCATAAAAACTTGGTTTTTCAATCCCATATTTATTACCTCCTCTA
AACTCTCTAGTACATTTATTAATCGTTGATGTGTTTATTTTTGAAAATTTTGTTAAATTA
AATGCGTATATACAAAATAAAACTGCCAAAATAATATATGAAATAGTATATGCAGTTTTT
GATACGGAATTCATAACCATAGTCAGAATCGCAAGTCCTACACAGATAATAGACATAGCT
ATGGTCCTATTACCTCCATTATTTCCAAAATTTAATATTTGCATTGATAAACAATATGCG
ATAACTAAGGATGGAAATGGTAGCAACGCGGAAGCTACAGCAATCATAATAATTGCAATT
ACTGGGGTTGTAGTGATAGCCAATACAAATAAAATAAGACCTATTAATGATTGAATATCG
TTTCTCATTAATATATCAGGAAAAGAACCCTTTAAATTTGGAAAACTTAACGTATACTCT
CCAGACTCATTTGGACGTGGAAGAAATGATTCTTCTTCCTCTTTGGTAAATAATTCCATA
TCACTTACTCCAGCTCCCGCATTAAAGTCTGAAAACATATTGTAATAACTTAAATAACTC
ATTTATATATTAAAAAATGTCTATCTGTACCATAATAGACTATAACTTATATATGGAGAT
GAAAAAAATTATTGGTGATATACCATTATTTCTATTCAATTATAAAAAAGATTTTGTTGA
AGTCAATAAAATGTCAAATTTTAAGTTTTATATCCCTATGGGATTTTTTTCATCCTTTAA
TACGTCATTAATAAGACAAATAGATTCTAAGTTAATTAACAACTATTTAACAATAACAGA
TATAAATTTACCAGAGTTATATCCGATACAGAAAAGAGTAATAAATTCAGTATTATCCTC
TATGAAAAGAAAAATAAAAGAAAAAAGACCTATGTACATAACTCTTCATTTATCTTGTGG
ATTTGGAAAGACTGTATTGGCATGTCATCTTATATCTATTCATAGACGAAAAACTGTAAT
TTGTTTACCCAATAAAATGTTAGTAAATCAATGGAGATCCACGATAGAAAATACCAATAT
GAATTATTTAATTTCTCTGGATGGTGTTAGAAATTTATTAAAAACATTAGATAATAAAAC
TGCAGATATATTAATAATAGTAAGTAGGCATTTATCAAATGATACATTTTGTAAAAGAAT
CCATGACGAATATGACACTTTCATTTTAGACGAATCACATATGTATAATCTTATGAATAA
TACATCAATAACAAGATTTTTAACATTTTTCCCACCGAAAATATGTTATTTTCTTACAGC
GACTCCTAGAAAGATAAATAGGCTATTTTGTAATGATGTAATAAATGTGTCAAAGGAAAC
AGAAATTAAAAAAATTATTAAAATAATAGAATATTTTTTCGAGCCATATTATACGGAAAC
AATAAAACAAATGATTAAAAAACTTAATCAAATAGATAATAAATATCATACTTATACAGA
AAAAATACTTTCAGAGGACCAACCAAGAAATAATCTCATTATTGATACGGTATTAAAGGA
ATTTAGAAATAACAGCATAAACAGGGTTATAATCATAACAAAGTTACGCAAGCATATGAT
ATTACTATATAACAAACTTTTAGAGAATTTTGATAATAATATTGTATATTTAGGCGACGC
TAAAGATAAAAACACATCTGATATAATAAAACTGATAAAAACAAAAGATAAATTTATATT
TGTTTCTACGGTACACTATTCCGGAACAGGATTAGATATTCCTAGTTTGGATTCATTAAT
AGTATGTTCCGCAGTTTTAAATAGTATGCAAATAGAACAACTTCTAGGAAGAATATGTAG
AGAGTCTATAAATTATAATAGGTATGTTTATATATTTCCAAATACATCAATAAAGGAAAT
AAAACATTTGATTGGATTCTTTTCACAAAAAATTATATCATTAGCTATAGATAAATTGGG
ATTTGAGAAAGAACCTAAAGCCGTAAAAGGCGGCAGAAAAGAGGAATCCGCACTATATAA
AGCATTTAACTTACAAAATCATTGAGTAATCTTAATTCTGATCCGCAAGCTGCACATGAT
AGTGTATTTCCTTTACCGGATACTTTGTATAGATCTAATGATACTTTGGTAATGTCGGAT
ACCTTTATTAACTTGGAATAACACGAAGAACATGTTACACAGTCATCATTATCTTGTATA
GTTGTTTTGGGTTTTCTTTTTCTTATGCGTTTTGCACCTCCTGTATCTTCCATTTAAGTT
GTAAAAAATAAATCTAGATACGCCTTAGAACACAGACGTCCAAAGTCCAAAATATTGTTG
TTATTTGTGCTATCGCATGATAAATATCTATTTTTATCTACACTTTTTATCCTCGAACAC
GTAAGTGGATTGTTCATTTTATCAATAGCCATATTTGCTTTTATTCCTGTTATGCCAAAA
TCATACATAAATAATCTATCTTCAATACAAATATAATCCTTTTTAAGATTTTTATATTTT
GTATATGCATGATATTCTCTACGCATTTTTTCTGATATTGCAGGAATTATAATATTGAAA
ATAAGAATGAAATAACATAATATTAAAAAAAGAGTTATCATGGCTTCTATCGACGATTTA
TCTAATCTAAAAGAATTAATAAAATTAAAAGATTGTATTCATATATCTGACCAGAAAACA
AGAGATAGATACAATTCTTTAATTGATTGGGCAACTGCAAAATATTGGAAAATTGGATTA
AATAAAACTGTTACTAATCAAACATCTATTAGCTCATATTACAATATAAAGCAAAAATGT
TTTACGTTGGAAAAAGGAAATTACATATTTTTACCAACTTGCTTTGGAAACGCATATATT
TATTGTAAAGGTAACATGATGGAATTAGGGTCCGGCGAAACAAAAGATATTGATCCTATA
TGTAAAGAAATTATAGATAAAATAATGACTAATAATAAAAATGTAGAATTTTTACGATTT
ACATATTTTAAAAATAAATGGATGTTGGAGGATTCGTTTTCTAAATATAGTTCGCCGATA
GATATCTTACAAATTGCATTTTCTGAAGGTATAAAAACTGTTCCCTATTTATGTATACAT
ATAAATGAGGATAAAATATTTACTGAAGATGATTATAATAGCATTGAGATATATTTTATG
AATGTTATGAAATCCAATGGATTTTACGTCAATTCATTATGTTTTTTGAAAGAAGGATAT
TTTGAACGAAATATAGTTGACTTTTTTAAAGTTACTTATGTATATATAAAGTCTATTGAT
TTAGAATATTTGGAAGATAATATGTATTTACCAAAATTGATATCAAAAACTGGAAGTAAA
ATATTGGTAAGAGACATAAATCATTTGATAGTTTCTAGAGCAAAAATAAATTCATTTGTT
AATGTAAAACGTAAAAATGGTTTTATGATTTTAGGAGAAAAATCTCCTTGTAATTCAGAA
ACTGAAGCAGAGACATTGTATAGAATATCAAAAACAATAGGTAATGATTTTTTCGTGAAC
GGGAAATATATATCGAAGATAAATAATAATTTAAGTTTAATTCAATTATCGGATAAATTA
GGGTGTGGGTTATGTAACACATTAGATGATATAGTTATTCAAATTAGAAAATCAAAATCG
TTAATTAAAAAGATAAAATCTGAATCTAGTTTTGAAATAATTAGGGAATGTTTAGGTTAT
CCAAAAACAGATTTTCTAACTCTGGTAAATAATATGAATTTTGATATAAAAAATTCTAGG
GTGATAAGCTTTAAGTTAGAAAACATAAATTGTTTAAATAATCCCAATTCTTCTGCAATA
TACGGAAATTTCAATAAATTTATATATCTCTTTAACATATTAATCGATGTCAAAGAATTA
CTATAATGCTCCCACGGAGCAAAAAGAAGTTATTTGTGCATTTGATATAGGTGCAAAAAA
TCCTGCAAGAACAATTATTGAGGTATATAACAACAATTCAATAAAAATACTTGATATATC
AAAACTTGATTGGAGTACAGATTGGGAAAAAAGAATAGCTAGAGATATTTCCCAATATGA
TTATAAATTTGTATTATTGGAAAGGCAACCTAGAAGATCTCCATATGTTAAATTTATCTA
TTTTATAAAAGGATTTTTATATCATTCGCATACAAAGGTTATATGCGTCTCCCCTGTAAT
GACAGGAAATTCTTATAAAGATAGAAAAAGACGATCCATAGAAACCTTTTTAAATTGGAT
GTCAATATTTGGGTTGATAGATTTTATCCCAATAAGAAGAAAATTGGACGATGTAGCAGA
TAGTTTTAATTTAGCAATGAGATACGTATTAGATAAATGGAATATAAATCATGCTCCGTA
TGTAAAACATAAATCCATAAAAAAATGTAAAATCGATGATAATTCGATATAAAGTTATAT
ATACAATGTATGATTTGTTTAATTTTCTATATGAAATTGAATGCGATTATTCACGTACAA
TTTTTAATTTTCACTTAATGAAAAATGATGGCATTTCTGATATATATGGAAAAATGAAAG
AACTTATATCTAATGAAACAATTTTTAATAATGTAGTAAAAACAGAATATATAAGATCTC
ACATCAAAAAACTTGTATATTGTGATATTAATATTACAAAACATATTATTAATAATAATG
TATATGATAATATTGTGACAAAAAGATCCAATCACAATTTCAAATGTTCACAATTTTTTG
ATATAAAGTCCGGAACAGATAAATTAAGTCTGTCAACGGTAAAAATTTTTGAACATGATA
AGTCATCACTGGTTTCATATATTAGAACAACAAATAAAAAACGTAAAGTAGATTATGGTG
AAATAAAAAAAACAGTGCATGGATCTTCTAAAACACCGAATTATTTTTCCGGTAAAAAAT
CTGATGATTATCTAATCACCACAATTAAATCTGTTAATTCACAACCTTGGATTAAAACAA
TCACAAAACGTATGCGTATAGACATAATTAATAATTCTATAGTAACTAAAGGAAAAAGTT
CTATATTGCAAACAATAGAAGTTGTTTTCGTCAATAGAACATGTATAAAAATATTCAAAG
ATTCGACTATGCATATTATTTTGTCCAAAGATAAAATGGAAACAGGATCAATTGGTATAA
TAAATAAATTGTTTAAGGTATATGAAATTTTATTCCATCTACTACATGATATAACAAATG
AAACTATTTTTAAAAAAATATTTGATATTTCATTAACTGTATTATCAGCAACAACATTTG
ATGAAAAAATGAATCAAATTAAAATTAATGAACATGAATACGGAATAAGTAATTTTGGTA
TAGGGATGTTTAATCTTACGTATATAAAACCGATTAACTTTACAGTATTTCCATCATTAT
TGGAAGATAATAACAAAATAAAGTTTTTTAAAGGAAAAAAATTAAATATAGTGGCCATAA
GATCATTAAAAGATTGTAAATATTATGTATCATTATCTAATTCAATTATGAAAAATATGG
AGGAAAGATCCAATATTCTAAATGAAATAAATATAGAATCTGTATGCATAGAAAAAATAA
AAGAACTATTAATTTAAAGTGAAAAAAAACACTACATAAAAAATGGACCAAAAGTTAGGA
TATAAGTTTCTCTTGCCAGATCCAAAGGTTGGAGTTTTTTATAGACCTTTGCATTTTCAA
TATATGTCATATTCTAACTTTATTAATCATAGATTACAAGAAATATTATCTGTTAAAAGA
ACTCTATTGTCGTTTAAAAATGATACGGAAAAAATTATAATAGAAATAGACAATATAAAA
GTAACCCCTCCAGATTATTCGCCTATTATAGCCAGTATAAAAGGAAAAAGTTATGATGCA
TTAGTTACATTTACGGTTAATATATATAAAGAGGTAATGACAAAAGATGGAACAACAATA
ACCAAAATTAGCAGCTATGAAGGCAATGATTCACATTTAATAAAGATTCCATTACTTATC
GGATATGGAAATAAAAATCCATTAGATACGGCCAAATATGTGGTACCGAATGTTATTGGA
GGAGTATTCATCAATAAACAATCAGTAGAAAAAGTAGGAATAAATTTGGTTGAGAAGTTA
ACAACATGGCCAAAATTTAGAATAATAAAACCAAATGCATTTACATTTTCCTTTTCGTCC
GTTTCTCCAGCACATATTCTTCCAACAAAATATAGACATTATAAGATACTTTTAGATATT
TCGCAACTAGATAACTGTTCTATATCCTCAACAAAAACATTTATAACAGTTAATATAATT
TTATTAGTACAATATTTATCCAGAATTAGCTTAGACTTTATAAGGCGAAGTTTATCTTTT
GATATGCCCCAAGAAATAATCTATTTAGTGAATGCTATTATAGAGAATACTAAAGAATTT
ATAACTAAAAATAATGATTTTGATATTGATTTATATATTAATGAGCTGATATTAGATGAA
TATAATAAACAAAAATCCCAATTATCAATAGAAGAATTTAAATATGAAATGATTTATAAT
TTTTTGCCTCATATGAACGATACACCTAATCAGCTAAAAGGGTTTTACATAATTTCATTG
TTGCGAAAATTTATTTATTGTATATATTATACATCTAGATATCCCGATAGAGATTCCATG
GTGTGTCATAGAGTATTAACATATGGAAAATATTTTGAAATATTGGCGCATGATGAATTA
GAAAATTATATAGGAAATATAAAAAATGATATTATCAATAATCATAAAAATAGAGGAGTG
TACTCCGTTAATATTCATGTATTGACTACTCCAGGATTTAATCATGCATTTTCCGGGTTA
TTAAGTGGTAAATTTAAAAAAACAGATGGTAGTTATAGAACACATCCTCATTATTCATGG
ATGCAAAATATTTCAATTCCAAGAAGTGTAGGATATTATCCTGACCAAGTTAAAATTTCT
AAAATGTTTTCTGTAAGAAAATATCATCCCAGCCAATATGCATATTTTTGCCCATCTGAC
GTACCAGAAAGAGGTCCTCAAGTAGGATTAGTATCACAGCTTTCAGTACTTACATCGATA
ACAAATATATGTACAAATGAATATCTTGAATTGGAAAAAAAGATATGTCAATATATCAGA
TCATATGATATTAACGATATAAGTTATTTTGAAACAGGATATTATATAACTTTAGAAAAT
TCTTTGATCGCATCATTAAATCCAAAATTAGTAGATAAGTTTGTAATAGATTTTAGAAGA
AAAAAAAGAATGGGATATTTTGATAATTTAGAAATTGGTATTACATTAGTAAGAGATCAC
ATGAATGAGATAAGAATTAATATAGGAGGAGGTAGATTAGTAAGACCATTTTTAGTTATT
GATGATGGAAATCTTATAATGGATGATATTATGGACAATCTTGAATCAAAAATGGAAGAT
ATGACATTCTCTGATATTCAAAAAGAGTTTCCACATGTTATTGAAATGGTTGATATAGAA
CAATTTACATTTAGTAATGTCTGTGAGTCAGTACAAAAATTTAGAACATTACCAAAAAAT
GAAAGAATTAAATTCCATTTATGTGATTTTCCTGCAGAATTTAGGGACGGATATGTGGCC
TCCTCTTTAGTAGGTATAAATCATAATTCTGGTCCTCGTGCAATTTTGGGATGTGCTCAA
GCAAAACAAGCTATATCATGTTTGAGTTCCGATATAAGAAATAAAATAGATAATGGCATA
CATCTCATATACCCAGAAAGACCTATAGTTATTAGCAAAGCATTAGAAACTTCAAAAATA
GCGGTAAATTGTTTTGGACAACATGTTACCATTGCTTTGATGTCGTATAAAGGAATAAAT
CAGGAAGATGGAATAATAATAAAGCGGCAATTTGTGGATAGAGGTGGATTAGATATAATT
ACTGCAAAAAAACATCAAGTAGAAATACCTTTAGAAAATTTTAATAATAAGGAAAGAGTA
AAATCTACGGCATATTCAAAATTAGAGAGTAATGGATTAGTAAGACTCAATGCATTTCTA
GAATCGGGAGATGCTATTGCGAGAAATATATCCTCTAGAACCTTGGAAGATGATTTTGTT
CACGATAATCAAATTAGCTTCGATATATCAGATAGATATACCGATATGTATAAATCTAGA
GTTGAAAGAGTCCAGGTGGACTTAACAGATAAAGTTAAAGTTAGAGTATTAACAATGAAA
GAAAGAAAACCAATTTTGGGGGATAAATTTACTAGTCGCACTAGTCAGAAGGGAACAATA
GCCTATATAGCCGATGAATCAGAACTTCCATATGATGAAAATGGTATAAAACCAGATGTA
ATAATAAATTCTACATCTATTTTCTCCAGAAAAACTTTATCGATGTTAGTAGAAGTTATA
TTGACGTCCGCATATGCGTGCAAACCATACAATAATAGTGGAAAAAATAGACCCATTTGT
TTTCCTAGTAGCAATGAAACTACAATTGATACCTACTTAGATTTTGCAAAAAAATGTTAT
GAAACAATTTATCCAGATTTGACAGAAGATGAACTCACGGATAAGGTATTTTGTGATAAA
GTATTATACGATCCTGAAACAGACAGACCATATATGTCAAAAGTGTTTATGGGTCCCATT
TATTATTTAAGATTGCGGCATCTTACACAAGATAAAGCCACGGTAAGATGTAGAGGGAAA
AAAACAAAACTTATAAGACAAGCAAATGAGGGTAGAAGGAGAGGCGGGGGCATAAAATTT
GGTGAAATGGAACGTGATTGCTTGATAGCGCACGGTGCAGCAAATACAATAACTGAGATT
TTAAAGGATTCTGAAGAAGATTATCAAGATGTATTTGTTTGTGAAAATTGTGGAGATATA
ACAGCACAAATACAAGGAAATAAAATATGCATACGTTGTTCAAAGCAAAATTTATCTACT
ATTTTGACTAAAGTAGATACCACTCATGTATCGAAAGTATTTATCACACAAATGAATGCT
AGAGGCGTCAAAGTTAAAATGGAATTTGAAAAACGAGAGCCTCTATTTTATAAAGAACTT
GAAAAAGTTGATTTAACTCCTTCGTTTTAATAATTATAATATAATATTCGTCCTGTTTGG
ACATCTATTTTTTTGCCTAGAGTAAGCATATTTCTTCTAACAGTTTCTGTGTGTGTTTCC
AGTCGTTTTACCGTATTCTCTAATACTTTACACCTCTCAATTGATATTTTTAATATTTTT
TCCATGACCATGAGTCGCAATACAAAATCTTTTATTTCCATTTGATCTTTATGTATAAAC
GAATCTTTCAATATATCTGAAATATCACTTTCATGTATTGGAAATGTGGGATAATTTTCT
TTTATTAATCGTTTTATATCATTTCTTATTGAGATAAGATTTGGTTCTTCATAGTCAATA
ATTCTTTCTTTGTATCTACCATCCTCTAAATCCTCTTCTTCTTCATCATCTCCAGGAAAC
ATCGTAAGTGGCTCTTCCATTTAAAGAATAGATTTTAAAAAAATACATTCTTTACTTTTT
GGATCATTTGGTGATATGCATGGATTAAATATATTTGAATGTGTTGACTCAGAAAATGTA
TAATTTATACAATCTTCTAATGTTCTAAATTTTCTAATATTATTACCGTCAGATTTAAAT
CCAAAAATTGAAATAGACACATAATCATTTTCAAATTTATTACATCTCCATTTTTGTTTT
ACGTCGTATATCTGATCATTTGGATCTTGAACACTTCTGTCAAGTGAAATAACATTGACA
GTTTTTGAATATTCTAATACAGAATGTGCATTATTAAATTCTTTTATATTGTCATAATTT
TTATATATAGAATATCCTTGAAAGAATATTAAACATACCGCAACGGTTGCAACAACTATA
AAAAAAATAGTAACTACGTTCATTTAGCAATAAAATTATTATAATATATCTATAATATTT
TTAAATGCCTCTGATAATGACTTTAAAAATGTTTCAATATCTATAATTGACATATCAAAT
TTATGATACGAATTTAATCTTGAATCACATCCAAAAAAGTTTACAACGGTCATGGTCAAT
AAGTCATTAACGAATAACATTCCAGAATTAGAATTATACGAAGAGAAGGATGCATGTTCT
TGTACGGATGTTTCTAATTTATGCGAATGAATGTCTGCGATTAAACATCCTTGCAAATAA
TCAAGGATTTCTTTTACATGACTTTTAAAATCTATCCATGAATAATGTTCTATGTAAAAA
GTTAATTTACCCAGTGGAGCTGTTACTATAAAAGGTACGATACTTAAAAAATTTGTATCT
ATTATGGGTTTTATATTTTCATATTCTCTATTAAAATTTTCTACGTTTAAAAAAGTTAAT
TGGTTTATAATATCTTCTGTTATTTGTGTGCCTGAACTAAATGCTATCAATTCTATTGTT
TGCAAATTTTTAAATCTATATTCTTGAAAGGTGTGTAATAGAGTCGCTGCTAATTCTTTG
GGTTTTTCAATTTTTTCAAATTTATTATCGGGATATATTATGAAATAATCAAAATCATCC
AATGATATATAATTTTTATTTTGAGTTTGTGATTTATTTAGATATACACAGAAACCTAAT
TCTCTTCTTAAAATTCTAGATGTATGTTTATAAAATATTTTTCTCGTGGGTAGATATTCT
ATCGCCGTTAACCATTCCTCATTTACCGCAGTTGTTTTATTAGTTAATATAATTCCTATA
TTTAATATAGGCCATCTAACTCTATTATTAAAACCATGTTTTATAAATGTTGCTATATTT
GGATCAAGATCAATAGCGAGTATTCTCTCTTCTCGGTACATAGTTCAATTGTTGTTCGTT
TTGTCTTGAATTTTTTTTCGACTTTTTATTTATAGATAACACTCTAAGGTTTATCTGGGA
AATAATTTCCTTTATAGTAAGCAAAGTTGCAGAAAACTCACTATCCGTATCATTGTTAGA
TAAATTTGTTAATAAGTGTATAAAATTTGATTCGTTAATATCTTCTTCTTCATTCATTTA
AAACTTATAAAGCATAAAAAATTATATATTTATTAATACTTATATTATTCAGTAATATTT
TCTTCAATTTTAGGAACAAATATATAAATTAATCCTCTACAAACAATATTTTTACTTTCT
AAAATGTAACAACTAGATATTATTTTTAATATCTTTATAAATAATTTTTTTAACATTTAA
ATCATTATGGATATTTTAAATATGTTAAAATTTTTAGAAAAATCATCATTTTATAATTTT
AACCTAAATATACCAAAAAATAAAACATATGTAGATTATAAAAATAATAAATTTATTTTT
TATAAACCCAAAGAAAAAATAATTAGAAAATATCTAACGAATGCTGGTATATATCATAAT
GATATTATAATATTTGGAAAAATAATAATTAATGATAACAAATTATTATTTTTTTATATG
GATTTGTTTTATTACGGCATCAATTTATTTGGAGACATTTACAAACTTGGTAGAGAAATT
GATAATTTATCTCTTAATAAAATAAAAAGTAAAAACTCATATTATGATGACGATGATTCA
GATGTTTATTATAATACATACTCATATGACGAGTATGATATTTATGATGATTATTATGAC
GAATGTGATGAAAATTGTGACTATTACGAAGATGAATAAATTATATTTTTATTTATTATT
ATACGATGATAATATTTTGGATAAATTTTTTTTCATGTGTGAAAATTGTTTTAATAATAT
TGCTGTATCTATATTATGATTAATAACATTTTCATCCGCACAATCATAACAAATTCTCTG
TTCTCCATCACTAAATACAGAATCTTCAATAATTAACACTCTTCGTTTATTAATACTAAT
AGATCTCAATAAACTAATAGACTTTAATAAATCCTTTTTTGATCCAGTTATAGACATAGA
TCTAAGCATATTTTCTATATCAGAATCGGATACATTACAGCAACAAAAATGTGTGATGCT
TGTACGGCCATTAATAGGTACATGTTTATATGTTTGACATAATAATACAATCGATGTATT
TAAATGTCTACCATGGTTTAAAAAATCTAATAAACAGCTGGACTTTGTTTGTTTATCACC
CATGTCATCTAAAATGAGTAAAAACATATCCGCCTTTTTTTGACCTTTATGTTCTATATA
TTTTTCAATTTTTTGTTTTGTGGTTATTAGAGCATAATCTAATTCTTCTGGTGTAGTAAC
TCTGTTAACGTGATCGGGCCATACATAACTATCATATGCTGAATTATAAACGGGGGTAAA
TAAGAAAATATGTTTATATTTTTCTACAAATGTGCTAAATAAAGATAATAAATATGCTGT
TTTGCCAGACCCAGACCCCCCAACCAATGCTATTCTAAATGGAGCCCTTAATAAGCTTTT
TCTGTAAAAATGCTTTTCTTTAAACCTATTCATACCTATTTACAGTTATTAAATTAATTT
TATGTAAAAAATAAAATATGGAAAAATAAGTCAATTATAGTAGACGATAATATATATAAG
TATACCGGTTATACACTACAAAGTAAAATAACACTAATAAATATGACTACTGTAGAAATA
ACAATGGAAGAAGGTAACGATAAGAAAGATGTTACCGAGACTGCCAATTCATTTGTTGGT
TCTACTATTTATGGACCTAAGTTAAAGAAAACTAAAAGTAAGAAATCTAAATGGTTGTCC
ATTTGTTTGAGGGTTTTGGTAATTTCATCGATTTTATCACTAATGGCGGTAGCCACAACA
TTAGCACTACAGTATAGTAAATGTAAAGCTGAATATGATAGTATAACAAATAAACAATCT
TTAGATTCTTACTCATTAGTTACTCCTGATAAACTTGACCCACGTTTTGAATGCAAGGAA
TGTCAGGGAATTATGTTCGATGGCGATTGTTACCAGTTTAATACCGAACACAAGACATTC
AGTGAAGCATCTATGGATTGCGCAGGAAAAGGCTATTCTCTACCCGCAACAAATTTGATG
TCAAAGTGGATCGGAGATTATTTGGAAAGCACATGGGGTGAGGAAGGTTATGGACTCTCA
AAGGAACGTGGAGGGAATATTGAATCACCAGATGCCAGCACAGAAAAGAGAAATTATTTT
TGTGTTAAATCGGTATCTTAAATTTATTTTTTTTGATATAAATGAAATCATTAAATAGAC
AAACGGTTAATAAACTTAAAAAGATGACAACACCTGCTGCAATTTTTATGATAATATCAA
CAATTATCAGTGGTATAGGAACAGTGTTAAAATATAAAACTGAACTGTTTCCTAGCGCCT
GCCCAAAAGGCTGGGTACCTTATGATAATTACTGTTATTTGGATACAAAGTTGCAGCTTT
CAGCATATGGTGCGGTATCTATTTGCAATAATTATGATGCTAGATTACCCAAAGCTAATT
TTAGACATTTAAGAGTAGCGTATTTGACTTATGGGAAAGTATTTTGGGTAAGTTTAACAA
GACACAATAATAGATGGTCTGATATCAATACAAACAAAACGGTTGATATGAATGGAAGTA
TGGAATTGATAAAATTAAATCAAAAACAAAAGAAAGATTCATGTTTTATATATAAATCTG
GTGAAATGATGGAAACCTTGTGCAATATTGTGAACTATATAATATGCGTAAAAAGGTTCT
ATAATTAATTGAAAAAGAAATAAATAATTAATATTTTACACATACTAATAAGATGGAGGA
AGATTTTACAACATTGTTAACTGTTTTAGGAACTATGAGAATTGAAAATAAGAATCTCAT
AAAAACCTATGATGATTTGGGTATAAACATTGTTGATGATTTTGGACCCTATAAACTCGC
ATCTTTGGAAATTTCTTTAGTTTCTTCAGAATTGTTAAAAACCTATGATTTACAGGATTG
TTATATAGCCCATAATGGAATTGTGTTACATTGTTCTTCTGATAATAAATTAAATATACC
GGTATATAAAGTGTATTCTGTATATATGTCTAAGAAAAGCATAATTATTTGTTTTGATGA
ATGTCCAAAATTGTTTATAGATGGAAAATCTCAACCTTTCTATATTTTATCTTCTTCATT
AATGATGGATGCGCATATTATTGAAGTGTATAATTTATATGATGAGGGTGATTATCATAT
TATTTTAAACCCTTCAAAAAATTTTCTAAAATATATAAGTGATAGATTTTATTTATGTTT
AATAGACAAAAATGGTTGGGCTATTGCCGATGGAAAAGTGAAATTAAATATTAATTAAGA
AATATCTTTAGTGTTATATATTAATTAATTATGAAATACATAAATAATGTACCTAATTAT
ATTATTAGCTACGTAACTAAATTGTTAACAAAAGAATATATATCACAGCATGATGAAAAT
AAAATAAAAAAAATCATTAATGAAACCATCAACGAAGAACATTCTGCATTAAAGATATTA
AGTATATATTCATTAACAGTTAATATAAGTGATATTAATAATAGTTTTAACTTAATAGAA
GATATAAGCTATAAACGGTGTCCAACTATTAATTATTATAACGGATATACATTGCAATCG
AATGACTATATTTATGTCTTGTGTTTACAAGGAAAAGCATGCATTGAAGTGTTTAATAAA
GAATCACTTTGTACATATAATATATCTAAAGGAGATATCTTTACAATGAATTATAATTCA
AATCATTTAGTAAAAACTAATGATAAAAATTTAAGATTGGCAATCATTATGTACACTTCA
AATTTTCCTTTTATTCATTATAAAAATTTAGTATTTTCAGAGGATAGTTTTATTTATAAT
ACCTTTTCAGGTTACAAGTTTGCATTAATAAGATTATTTGATGAATCAGATACCTTGTTG
GAGGATATAATATTAGCCAATGGAAGATTTTATACCAGCGACCTTACAAAAAAAAATAAA
ATTATTAATATAAAAAACTTATTGACTAAATACGATATTAATAATTTTAATATAGATTAT
ATACCAAAAAATGATAGCATTAACACTAGTCTTGAAATTGTTGAACTTTCACTGGATAAT
AACACTATAAAAGGTATTTCCGATGGAACATATACTAAAAATATATATTCATCAGATGGA
ATAAAATATAAATTACTAATATCTTATGGAGTTATATGTAACAACGGAGATTAAAAATAT
TTTTTTATAAATATTGAATTATTAAGTCACTGTTATAAGCGTAATTTATCATGGATGTAC
AACAAATAGTCATAATCTGTATCATTGTATTATCGTGTCTAATCCTTATTTTATACGTTA
TATCCATTTGTAAAGACACAATTAAAAAATTTTATAAGAAAAAGAAAACAAAACCAATAT
GCATTAGATTAAATTCTATCACGTATTCAACGAATAATGCCAACAACGAGGATATAAAAA
CAGGATCTCAGAGCAGTATAAACAGCGATTGGACAGATTCTAGCGGTGAAATATATGCTA
ATTTCAGATCCAGTAAAAAGGAAAAAAGCTTTAAAATCACGAACAAAAAAGATAATATAG
AAGTAGAAATTGTTGATTCAGATGAAGAATTTGAACCCGATTCAAAGGATGAAACCAACC
TTAATTGGGATAATGACGTTAATGGAGTTTATGACTTACCACCACCCCCAGATAATATAG
ACATGGAAGAAGAGGATAGTTCTTTGTACAGCCTTCCTCCACCCAGTGTTGAAACTGTTG
TTTGTGAATTTGAAGATATTAAACTGGAAGATGATGAAGTTATATATGGAAATACTATGA
GTATAATAGCTGAGAGCGTAAAAAATAAAAGTTATTATGATTATCATTGGGTAGAAGAAA
AAAACCTATCGTTAGAATCAGATAATTCACTTGTCTGATGATAATTTTTATAAAGTGAAT
AATTATATACAAAATATAAAGCGTTACCATATTTTTAAATATGAAAACTAAACTGTTTAA
AACTGTTCCATTTTTTAGTACATCTAAAATAAAAAACCGAATATTTGAATTAATAGATAT
GAATATATTAAAATATTATAACGATAATCATACAAAAATTATTTTATCTGAGATAAAGCA
ATATATAGATGATGAAAACATTTGCATCGACGGTCTAATAAATATAAAATATTGTGATAA
AGATTATTCATTAAGTGAATATAGAAACTCAGATTATAGTAAAATACTTATTTGTATACA
ATCAGCTAAAAAAGGAGGAATGTTATTAATAACGAATAGAATTACAAATCATAAAAGAAT
AATTCATCCAAATCCTAATTGTATTATTATATTAAATCCATTAGCTGATTATACGGTTAC
GCAAATAGTTAAAGGATCTCTAATATTTATAGCTATCAACATATATATACCAAGTATGAA
ACTTGTAAAAATGACTGTTGAAAATATAAAATATTCAAATGATATATCACTATTAGTTCC
TATAAGTAACAATGAATATATGTTTGTGATAAAACAAATTATAAACGCGAATAATAAAAA
AATTATGTGTGAACAAATATTAATAAATAAAGAATGGTTTACATTAATTACTGATGAATC
GAATAATAAATTTTATATTCCATCAATTTGTTTTGGAAACTCTTTATTACATTTTAATTA
TTCATATATTTGCTTTAAAAAGGATATAATCAGTGATATTATAAATAAACACATACCGTT
TGAAAAAGTATATCCAAAAAAAGGTATTTATAAATCGATAATTATTTATGAAAAAATTAT
TTATGGTAAATATATAGATAACTAAACAAATTTATTTATATTATCCTATTGAAAATGATT
CAATATCATCCGTTGTTACATGTAATTTTTTATATATTATGTTATGTCCCAATGGAGTTA
TGAATAATAAAACTAAGTTACAAAGTTCTAAAACATTAATAAATAAAAGTTTATATATAA
ATAAATATATGTATATTTGATTATAACAACCAACGAATGATAATATTAATATTATACAAG
AAATTAAATAACTAATTACCTGTAATACCAAGTTACCTATAATTAAATATGAATTTTCAA
CATACTTATATAAGTGTATCTGAACAAACATAGATATTAATATTGAAATTTGTATTAGTA
TTATTCCTTGAACCTTTACAAATGTAAAAATGGATGAAATACTAATCATATATTGACCTA
TTAACAGTATTAATGTTATCCATAGTGATACAGCATATAAGTATATTATTCTTTTTAGCT
TATTAAGTTTAAATGTAATGGTTATCAATTCACTCCATAAGAGAATTATAAATATAGATA
ACATACTAATAACGATTTCTATTTCTTCTTTGGTAAACCATTCGCTGGTATACTGTAACA
TTATTATATTCTTTATCTTGTTAAATTTGCTGGCTGCCTCACATGTATAATTTCCAGTTA
ATGACGTAGAAAAATTAAATAATAAAGAAGATAAATTATAATAAGTTTTATTAACCAAAA
ATATGCTATTCCCATCAACTTTCCATCTTATATCGATATTTGATATATTATCATAAATTA
ATTTATCTAAATTACATGTCAACAAGATTGTTTTATTGCAACTTGTATACATAACCGAAT
TAACCGTCGTTAGTGTTTGCTCTGAACAGTAAAAACAAATAAAGATTGTTAAAATAAAAA
AGTATATTCTAATGGATACCAGAGAAGAAATATTCAACATTTTGATAGATAATCATGGGA
CCCACTATTCTTATTTAGATTCAAATAATGATGAAGTATCTATAAAGAATTTTTCTAATT
TATGTAAGGAATTTATACATTCAGGAAAAAAGGATCAATTTATTAAAGAAAAAATTAAAA
ATATATTATTAAATATTCCAGATTCGATGGTTTCACAAATATGGTATCCAATAGCTAAAT
TATGCGATATAATTACATATTATAATTGTTCAAATAATACCTGGATTGATTCACAATTAA
ACGATATAGATGAGTCTCTAATACCTTATTTTAATCTAATCTCCTATGGCAATTTAGCAA
GAGTTGCTATAACATATCCATTTACAGATAATGGAAGAAAATGTATTTCATTGTTAAATA
AAGCTCTTTTTAACAATGATAAATAAAAATCAGCTATTAATTTATTATATTTAAATAATG
CTAGAATCATACAATACATACGCAAAAGTAAATATTAATGTATCTACAAAAGATCAAGTT
ATAAAAATAATGATAGGTTCATCTCCTTACATGGATGTACGTATCGTTAGTAATAAATAT
GATAAGCTTTTTATCTCTAATGAAGATGAAATGAAAACAACTCATGAACATATAAAAAAA
GAAAATGAGGATGAGAAAAAATCAGAAAAACCTGAAAATGAGGATGAGAAAAAATCAGAA
AAACCTGAAAATGAGGATGAGAAAAAATTTGAAGATAGTGATTCCAGCGATAAAAACCTG
TAAATTAAGTTAAAAATGTTTACTCAATATAAAATATTGAATTCATATATTTTTAATTAT
AATTATATCCATGGAAGAATATGATAATATAGCTATAAAGATAACATCAGAAAATGGTAG
TACGATATCAGTATGCTGTGAATCAAAATCTAAGATTACTATTGATATAGTTACAAAAAA
GAATCAATCAGTATCTACTAAATCAATAATAAAGAAAAAGAAACTAGAAAATACAAAAAA
AGATGATGAGTATAATTATAATACCGATACCGAAGAATCAGAAAATGCAATGGAAATAGA
TTGCATTAAAAATTCATAATTAAAAATTATTTTTCTGATATACATTTTAACCAAGATGTT
GTTCTTTCAAATGATTCATCTGGGAAAAATATTGGTTTATATCCAAATTCATTTGCTTTG
TTTGTATTAACGATAAACTGTGTTATCGCTTTAAATAAAATGTCTCTTGATAACATAGGG
TATTCATCAGGATTATTTTTTCTTATCTTCTTATTAAAAATGGACGCAATTTTAGAAAGC
CATAAAGGTATTTGTTTTCCTTCTTCGATTCCCAATGGTTCCATTAACATAAGATTAAAT
ACATCGTATTCACAACACGGTGATAAATCATAACAATAGTATACATTTCCAGGAATTTTA
GAATTTGGGTTTTGAATTTGTCTAGCTGCCAAAACATGCATCCATGCAACATTTCCAACA
TATACTCTACTAGTTTTGATAGTTTTAGGAACCACCATTGGCATCATATTATTGTTGTTT
TTGCAATATTCATAAATCCTTTTGAGTGTATAATTTTCTTCACCATATGTATCTACGGGT
CTTAATACGCAAGTTTTTAAGGTTTTTAAATTTTCTATATTAATTCCGTTTGAAGAAATA
ACAATTTCTTCTGATAATAGTTTACTTTTACAATATAGATTATCATGAATAGACTCATAA
GACGTATTCTCATTTCCAAAAAATGGTTTTCCTAATTTATTGGGACCTATGGAAGAGGAG
TCTCCTGTATATATAAGATATTCAATTCCATTTCTTACACACGCAGTTATAACATTTTTT
ATGGATGTTATATTCATCTCATAAATTTGTTCATCCGTATATACTCCGTTTAAACTGGAG
ATGGATACGGTAGTTATAACTAAATCAACTCCTTTTAAAATATTTGTTAAGTCTACTAGG
CTACACACATCGCATTGATGATAACTTATTTGTACATCATCTTTAATCGATTCCTTATTA
TCTGTTTTTATATCTATAACTCTAATTTCTGATATTAATTTATCACATTCTAATAGTAAT
TTAACTATAAACTTTCCGATAAATCCGCAACCACCAAGAACAGCGTATACAGACATTATT
TTATTTTTTTATTAATGACTATTTATTCATTTTATAATATTCAGTTATTAAATGAATAGA
TATTACAGATATTATGAATTTAATAAAGTCATTCGTAGAGCCGTATGTTTATTAAAAGGG
ACTAATATACAAGGAGTTATTAATTTTGAACAGTTAGAAAATGGGATAAATATAATATTT
GGAGTTATACTGGGTTTAAGGGAAGGCTATCATGGAATTCATATTCATGAATTAGGAGAT
GAAACCGACGGAGCAAATAGTTGCGGATCACATTTTAATCCTAACAATAGACATCACGGA
TCACCTAATGACGAAGAACGACATATAGGCGATTTAGGAAATATTTATGCCAATAAACAC
GGTATCTCATATGTATATATGATAGATGGTCAAATATCATTAGATAACGAAAACTCAATT
ATAGGAAGAGCATTAATTGTAAAAGAGAACGAAGATGATTTTGGAAGAGGAAATGCTGAA
AAAAGTCATATCGATGGAAATTCTGGAAAAGGAATAGCTTGGGGAATTATCGGCATTTCC
AATTAATTGATGAATCAATTAAATAAATTTCAATAGATCATATTATAAAAATCATAGTAA
AACAGAATATCTAATTTTCATGAAATAATTTTTGTTCCTGACGACTTTTTAAAGTAGTCA
TTTGAGCCAGATAGGATGCTATATTAGTGTATTAGTCTTATATGTTACAATAAAAATGTT
AGTAGATTATAACAAATGAAAGTTTTTATTTCATGTGAAAGCGGTATGATTTATTGATTA
ATTAAGCGAATAGATGTTACGGGTAATTATATGAATTATTAGAAGGTATATAGATATTAG
TATATGTTTTACTACAAATCCATTTTCTATTCGCATAAACTCTGGAGCTACTAATTCTGA
TGTCATTAAGATATGCACATTCTCCAGTTCCTGTAATAACAAATGATGAGTTATAATTTG
AATTATCTGCCCATTTCCAAGGATGATTTGAAGATTCTCTGTTAAGTCCGATCCAATGAT
CTGAAGAATCTTTATATCTTTTTAAAAAATTTAGTTCTTCTTCCGTTTCAACTTTAACAA
GAGTTGCTCCCAATGAAGTACAAAATGTGTTGCCAAATGTCCAATTTTTTGAATCTTCAG
AAAAGTAAAAGCATTTATATCCAAATCCAATCCATCCCTTTGGGCAAGTAACATATTTAA
TGGTGGGTTCCTGAGTGTCGCTTTTAAATGCCATAAGAATGATAATAGGTACCAAATTTA
TTGTTATAAGAATACAGATGGTTATTATGCAACAATAAAGTTTTTCAGGAGTAACAAAGG
ATGTAAATTGAACATAATTTTTTTGTGTTTCTGTTTCTTTATCAGAGTTTGTATCGCGAC
AATCATCCTTACCCATTTCCACAATTTCCGTAGTTGGTTTTAGCGCCATTTTCAGTTCAG
GAAACATGTTCGATACTGGATTTTCTATCTGTGTTTAAACGAAACACATATGTATATAAA
TTCATTTTTATTCAGTTTTATTGAAAATATGATGTTAGTTGAAAATGTTAATAAAGATAT
TTATATTGTATCTATTATTATTTTATGTGATTAAAAAAATATATAAATAATCAAAATTGA
AGTACAATATTTTTTCTATAAAATGGATGATAAAAAATGTACGTTTAAAGAGTTTAGAAG
ACTTTGTAAAAATGTGGCAAATACTCCAAAATACTTAGAAAAAACAGAATTTATTAAAGA
TTTTATTAATAAAAAAGGAGATGAACAAACATTTATTATCATAAAGATGTTATTACCTAT
GGTGAATAAACGAATTTATAGATTAAACGACATACAAATAATAAAATTATTTAGTAAAAT
ATTTAATCATGATATTAAAGATATGTTAAATGATCTAGAAAAAGGATATGTTGCAGACAC
CATAAAAACATTTTTTGAAACCAGTAAAACTGATATTATTCCAATAAATAGAAGTATTTT
ATTATTAGAAGATGTTGATAATTTTTTACAACACTTATCTACATTAACAAAGGAAAATGA
TCAAATAAACTTTTTAAATATGTTAGCAAAAGTATGTACCGGAAATGATTTAAAATGTAT
TATATTACTTATTAAAAATGATTTACAAATAAAAGCAGGTATAAAATGTGTCCTTGATTC
TTTACATCCAAATGCATATAATTACTTTAAAACATCTCATAATTTAAGAGATATTGTTAA
ATACTCAATAAATGATTCATTATCTAATGTAAAGATTAATCCTATGACTCCTGTTAAACC
TATGTTGGCTGATGTATGCGAATCTCTAGAAAAAGCAATAGATAAATATAAAGATGGAAT
GTATTCAGAGGTAAAATATGATGGGGAGCGTGTACAAATTCATAAAAAAGATAATGTATA
CAATTATTTTAGTAGAAATTTAAAACCTGTTCTTACTCATAAAATTGATGGATTTGATAA
ACTGTTGACTGATGCATTTCCCACAGCAAAAAACTTCATTTTAGATGCGGAATTAATAAT
GATAGATACAAAATCAAATTCATTTTTACCATTTGGTTCATTAGGTATACATAAAAAAGA
GTCCTATGAAAATTCAGTAACTTGTATGTTCATATTTGATTGTTTATATTATAATGATAA
TAATTTCATGAATTTTCCATTTCATAAACGTAGACAGTTTCTTAGAGATAATATTTATGA
AATAAAAAATAAAATCATGTTATCGGAAATACGATGTATATATTCAATATCGGATTTACA
AATAATCATGAGTAATATTATTAAAAAAGGGTTTGAAGGAATTATGATTAAAGGGGTTAA
TGACGAATACAAACCTGGAAAAAGAGGTTGGTTGAAGATAAAAAAAGATTATTTAGAGAA
TGGGTCTATGGCAGATTCCGCAGATCTTGTGGTATTAGGTTCTTATTATGGAAAAGGATC
AAAGGGAGGAATACAATCAATATTTTTAATGGGATGTTATGATTCAGATCGTATGATTTG
GAAGACTGTAACAAAATGTTCTGGTCATGACGATAAAACGCTTCAACAATTGCAAGAAGA
TATGGAATTAATAAAAATAAGCCGCGAACCTGATAAAATTCCAAAATGGTTATCCGTTAA
TAAAATATATTATCCTGATTTTGTAGTGAAGGATCCTAGATCGGCACCCGTTTGGGAAAT
TGTGGGATCCGGATTTACAAAATCCCAATATCATACTGCCGATGGAATTTCTATCAGATT
TCCAAGATGTCAAAGAATCAGAAATGATAAAAATTGGATTTCTGCTACAAATTTAAATCA
ACTAAGGGAATTATATAAAAAATCTATATAATTTTTAAATTTGTACTAATGTACTTAAAA
TATAAATTTAAGCATTAAAATAAAAATTGTTTTGTTCTATTGCAAAACAAAATAAAGTAT
TTTTTCTGGTAAAAAAGATGAAAGTATCGTTCATAATATGCATCTTCATTTTACAATATT
GTTTAATTAAAAATGAAGAACTTCAATGTTATAGAAAGTTGGCATTATATAGCTTTTATG
ATGATCAGGTTGCCTCATCCCCCGTAATATTTAAAGAGTCCTCATCACTACAAAATTTTG
ATGATTTGATATTTTTAAAGGCCAATGAATTAAGTAAACAAATTAACTGGACAAAAATAA
TTGATAGTATTAGTGATGAATTTAAAAGCAAATGTATGAACAGCAGTGATACTCTTTATA
ATAGTGTACTCACTGATATATTTACCTTAACTATTAATGACACAATCATTGATGAGGATA
TATTTAATAACGAATCAGTAATATTTTATTATACTACACAAACAACTAATATTATAGAGG
ATACAAATTGTATAAACAATAATACAAATTGTACAAAGTATGATGAAAATACTTTCAATA
ACAGCATTGTTACTTTTAATGAATCTTTCATTACAATCTCATTAGAAAATATGACAATAA
TACTTAACAACACGTGTGATGATGTATCTATTCATACAATAACAATCATGTCAAATTATT
CTCAACTTTTGATAAATGTTACTTCAGATACTATATCTACAAACCTTCCTTTTCTAAAGA
GTGATATGTTTAATAACTGTACACTAACACAACTAGTAACTATCATATATAACAATGAAA
CAATAGATTTATCCCAATATTATAATAATACAGAAAGAAACATTTATAATGAAACAATAG
ATCTATCCAAATATTATAATGATACAGAGGAGACTATTATTTATGTGCAACGAAATAGAT
CGTTAAAAAATTTATGCGATTCTGCATCAATGGAAACAAAAGTTCAGTCTATTGGAATTA
TAGATGTATATAATCAAACATTAGTAAATATGAGCATTATTCCAAATAATGAAACTGCCG
CATATTATCTATGTGTATTAAGCGGCACTAACAACTGCGGAATAGACATATTTGTCGAAG
CCGCATCAAAATATATTCTAGAAGAAGAGAATCAAAAACAATCAAAGAATAGACGCAAAA
GATCTATAAATATGGAATTAGATGAATTTTGCTTGCATAGGAATTATGATCTGACGAGCT
TAGAAGATTGTACTAACACGAATATCAATAATAAAGCCATTGTTGTCAAAAATATAAGGA
AAAGAAGATCTCCTCCTGGAAATAATAACAAACCTCCAGTTCCATCCAAAGGAAATCTTG
TTTTACAGAGCGCTGATGAACTCGGTGCGAGACCTAAAATTAGATCAAGAGTTAAAAATA
TACAAGTGGGTGCGCATGGAACGGATGGATCAGTTTCAGGAAGTGAAGAAATTTATTCAA
ATGTTAAATCTGAGATTTCAGAAAAGATAAAAAGGATGGTCATCACCTCGAAAGGTGATT
TGACACCGGAAAGACTTCCTTCATCAACCAGGGCACTAATAGGTAGTGTTATTCAATCAA
AAATAGATACAGTTTCTGAATCCGAACATATAACAAAACAACTTATAGAAAAGCAAAAGC
CTGATGCTACATATGCAGTACCCATGAAGAAAGGAATTATTGTGGAGGCGGGAAATAGAC
CTTCATCCTTGTTAGATGTAGATACCTCTTCAAAAATATATACAAACACTTTAAGAAATA
GAGGAGATACGCTTATCAAGACTAAAAATCGCCATGTAAGAATATATGAAGAGGAAGATA
CATATTTCTTAAGAGGAAGATTGTCATCGTCTGGTTCTGAAGAGGATACATATTTTATGA
GAAGAACTCCATCGTCTAGTTCTGACGATACATATTTTCTCAAAGAATCAGATAATAGAG
TGCCATCTCCATCAACTACCTACAGTTTACCAAACAAACCAAAAATTAGAAATCCATCAT
CTTCATCATCTACATATAATTTAGCTGGTTTACCGCAACAAAATAGAAATCCTTCTTCAT
TGACGTATGATTTGGCTGGCCTACCCTCTCGTAAAAATAAAAACCATCCTCCTGAAAATT
ATTATGAATCAATAGATGATGAACATGTGTATGAATCTATTAACGATCCTGTATATAGTT
TAGCTGGCAATCCTAAAAAACATGTGGATAGAAGTACACTTCCTGTACCTCCATTACCTA
ATGAAAATAAAAAGAAGAAAATGATTGATATGATTTGTGAATCTAAGTCAAGATCATCAA
TTTGTAATGTACGCAATTTTGAAGAGTCATTATATGAATCAATAGACGATGATCAGTTTT
CAAAAAGAAATTCCTTATACGATACTACAGGATTTAAGAGAAATTCTTTATATGACACAG
CAGGAGGCGATCATTTTTCAAAGAGAAACTCCATATATGAATCAATAGATGATGTTATAT
ATAATGATTTAAGTGGACATCAATCATTGGTTAGAAAAAATGCTATGAAGAAAACCAAAA
AACAATTAAATACACAAAATGAAGAATTTGTAATAACGGTTAAAGAAGATGGTAATAATG
ACATGGATAACATGGATATAAATAATAATAACAACAATAATAATCATGGAAATAATAATA
ATAACAAAAGAAAGGAAAAAACTAATAAAAAGTTGAATGAACTATCTGTATATGATAATA
AGATGGATAAAATAGTTAAAACTATAGCTTTAAGTACTTATTTATCTTCAACCAATACAA
GAATATCTTCCATTATGGCACAAGCACATACTCAGCCAAAAGAATTAACCATTGTAAACA
TTATATCATCTGTGTTAACACAACTTGGTGGAACATTAGCAATTGGCGGTGCCGGGTCTC
CAAAAGCTGCAGTTGCTGGATTGGCTTTGCAAGGAATAGCTGGTTTAATTGATGCCGCAA
CCTCTATTTATTTCTTGCTATCTGGAGAAGAGCCACCAAAAGATCCCGCAATTGAAAAAT
TTTCTAATTATGCATCTTATGTTTCACAAACAGATGCAGGAGCCAGAGTATGTATGATGC
CAGATTCTGATATTACTATCACATTGGCATATAGACATAACAATATGAACAACGAGGCTG
AAAAAGTTAGAGGTGAATATACAGATACAATACCTAGCAAAGTATATTATTTGAGAAATA
ATCAAATTAGTTATACTGTGAAAATTACATTGGTATGCCCCATAGGGCAATTGAGATTAT
TTGAAGCAGATGTAAATAATTATGCAACTCTTTTGAGAGAGGATAAAAATGGTGTAAAAT
ATTATCTTGTACATGGAATTTTAGAACTATTGTCATATCATCCTAATGTAACCTTTACAT
GTGGTAATGAACCTGGTGTTATATTCATGCCCTTTGATCAATCATTAAGCGATATGCAAT
TATTAAGAATATCAACACCCGGTGAACCATATTCTGCAAGAGAAATGCCATCAAATGTAT
GTGATTTATATCCATTAAAGAAATTTTATGTTTTGGCCGGAAATTGTCCATATGATATGA
GTAGGATATCCGTAACATATGTTACTTGTAATACTCTATTAAGGATGTCAACATATGATT
ATGAGAAAAATAGATGGATTTTAATGAATCCGTTTTCAAGAACAAATGAAGATTATATTC
AACTATTTACATTTTCAAAATATGATTTTAGTTCTAAATCTGATACTATAAACTTAAATA
CTATAGGTCACAGTGGAACTATATGTAGCCAATTTGATACTAATACTTGCTATTGGGCAG
ATTCAATGATATTAGAAGATGTGACTTCTTGCAATTCTAGAATTAGAAAACTTCATGTTG
AATTAGCCGTAGTATCTGATAAAGGATATAACAGCTTTGTTCTTAATTGCCCTTATGGTT
CCACACCATTTCATATAAGCAATGGTTCAATCATCGAAATTCCAATGAATACACGACGAA
CATCTGTTAGGTTCTTATCTCAAAGTGAAAATGTTGCTCTAATATCATGTATACATAATT
CAAATCCTATTTACAAATCTGACATCATTAAAATAACATTCAAAAAATCAGATATGTCTT
CCAAATACCTCGATTTTAAGAATTTTAACGATAGAAAATATTTATTTGATTCATTTAGTG
ATATTATGCCAAAGAGGTCAAAAACTTGTAAAAGATATAGTGAGAATAAGAAGTGTAAGA
ATTATTATCAGATAAAGCATCATCCTGAAATAGATTATAAAGTTGTGGTTGTCAAAACAC
CCATGGTAAGACTCACGACTAGTTACTCAGGCCCACTTAACGAGTATACATTGGCTAACA
TACGCAATTATTACTCTTCTCCTATACAAATAAATTTAGATGTTAGTTCATTATCCAATG
TTTATAAAAATCCAGATCATTTTTGGACATTCGCATTAAAAAATAAAAGAACATTTAGCT
CAATAGTTGTAACATTATTTCCTTGTTCTGTGGTAGCTGGGAACATCGATGTAAATTATG
GAATTCACAGTAAAGGTAATTATGATAGATATGGTAGAAATGGGAAATATATGTTTATTG
GTTCTAAAGATAGTCCGTCAAATAAGCGTATAAATTTTAATTTTGTAAAAGATCATATCA
ATAGTAAATTAGAAAATGAATTTGGTAAATGCGATGTCCATTTAGATTTGGAATCTAGGT
TAGTTAAAGTTTCATGTCCAGAATTTACAATACCTCAAAGGCCATTTGATTCGAATGATA
TTAACAGTTTATGTGTATTGGTTACTACATCTAGAGATCATTGTGCAATCTCAGAAGAAG
CATGGTCAAAAAATGATAGAACTCATGGGTATGGATATAGTTATGAAGAATCAAATATGG
AATTTAATTCTTGTGTGAATGGAAAAGGAACCAGGAAACCCTTAGATAACTTTTGTTATT
ATTGGTATTTGGGGACATATTGGGCGCCTGATTATGATCCCTGTGCATCATCGATGGTAC
TTGGGTATTCTCCTGTATTTTTGGAAAATAAACTTGTTAAACCTCCATATATTAAAGAAT
TCGGATATAATCCCGGAAATAATGAATATGTGAATAGAGATTTATATAATAGATTGCAAC
ATTTATATGATAATTATAATAAATTAGTTATGTATTCTCTAGATCCAGTTGTTGAAATGT
CTAATGAATTCGCAAAATCTATGACAAAAGAAGGAAGGGAAATTTTCAGATTGATCGCTG
ATAGTAAAGAAATACAAACTGTCAGAAAGGAAAATGAATTGAAAGCAGAAAAGATTAGGG
ATGAGATAGAGAAAACTTTAAATGATATTTATGTTAATACTTTGACATATTCTGAAACAA
CTGAATTACTAAGATCATCCATAAATACAAGATGTTGTGTGCTTAATGGTACAGATGTAT
ATAAGTATTTTACTTTAGAATATTATTTATGTGGAACATACGATGATTATCGTATAAATG
TAGATAATAAAACATACATAAAAATAAATAATACACTAATTGAAGAAGATATATATTTAG
CACTAAAAATACCTCAAGTAACATGTTTTCAAATATCATTAATATCTGTGAATAATGAAG
AATCACAAAAGAATTTTGAAACAGAAATAGTAAGATTGGCATTTGAGGATGTTCTAAATG
ATCTGTTTAAGGAGATTGATAATAATAAAACATTATATTTTATATCATTTGAAAATGAAA
GAAGAAATGTGAACAAAATAAATGAAATTGATAAAAATTTAATATTAAGCATATCCATTT
CATTAGCAATAACCGTTGTTTCAACGATAGCCATTATCCTCATCATTAAAAGATCAAAAT
ATAAAATGGGATCATACAATATTAATACCACACAAAAACCTCTAAATAATAGTTCATTAA
AAAACACGTATGTATCATTAATTGATTTTGATGAAATATATTATAAGATTAATAATTAGC
TTTTTTATATAATATTTTCATGAAAATAAACATATTATTTTTAAAAAAGATGATCTTAAA
ATTATTATACATTTTCATGGTGAGTGCTACAGCAATAAATTTAGAAAATGATTTAATTGA
ATTGTATAATGGATATAAAGGTTTATTAAGCGAACATCTAAAAACTGTTATAAATGAAAG
CTGTTTATTTGTTGGAGAAGATACTAAATTTGCTACAAATAAAGAATTATTGCGGTTAAC
TTGCCCAATTACTAAAGATAGATTATTAGGATTTGTTACACAAAATAAAAATAATTATGA
TGTAATGTGGGAAACAATATCATATAATGTAACATCACCATACATCTCTAATTCAAATAT
TGATGATCAAAATTTGATATTAATTCCATATAATGAAAGCATACATGGTGATACATTTTT
ATGCACGGTTTCGTATATGGAATTGTGCTTCCAATCTATCATACATATAATGAAATATTC
TGCTATGGATAGCTGTAAAAAGAGCGATATGTCAGAGTTGTCAATTAGCGTAGATTTATA
TTGTGGCATATTGCACTATCCTTATACAACGATAGATTGGTATAAGGATGGTAAAAAATT
ATACATAGATAATAAAAAATATTCAAATAATAATAAACGTTTTTTAACGATAACAAATAT
AACACACGAAGACGGTGGAATATATAAATGTAATGGATATCAAGATCTAGATAATATTAC
ATATTCCACCAGCAGATGTATCGAAGTATCAATTAAAAAAGTATATGATTTTATTTTATA
CGAATTGCCTACCAATACAAACGTGACAGAAGGGGAAAATGTAACGATAGACTGTTATGC
CGTATCTAACCCTGAAGATTATATAGTTTTAATGTGGGAAGATGTTTCATTCGGAATATC
CGCATATCAGATATCGTATGATTCAGAATATAAGGATGAAAACACCATACTATGGAATAC
TAAATTGTTTTTAAATAATATAAAAAATGAAGATAATGGCACAATATATACCTGCAGTGG
ATTTAATGATTATATTACAAAGGTAACTACTACTACACTAATAATAACTTAAAAAAAAGT
TCATTTTTTGAGACATTATTATGTCTGATCTGACAAAAGTTAGCACTTTTGAGGAACGCA
ACATCTCCTTTCGTATGAAAAATACGGAAGCTGGAAAAGACTCAACTATGATGGATGATC
TGATGAATGATCTGATGAATGATTTTAGTTTGATGTTCTTATATGATACTGCGGATAAGA
TAAACGATCACGACTCTTTGGAAAATGTGTTGGAGGACTATTTTGCGTGGAGAGCGCATA
TCAGTAAAATAGATATTTTGCCTAAAAATGTAGGAAAATTATATCTAGATTTAATGGACT
TGGATACATTTGCCAAAAAAATGATGGGAGATTTGGATATCCTAATATTGGATGTATTAA
AGCTGGATGAGCAAGATGCGGATGTCAGGTTATTTAATTTTATCTCATCTACGGATATAA
ATTTTAACAACTGCGATACATGTTTAATTTTAATAGGCTTTATTGGGTATGTGTGCAGTT
TTTGGGGAAAAAATAATTTAATTAGTGAATATCTTCATTCGGTCATGCGAGGATTCTTGA
CACATGTTAATGTAGAAACATTAGAAAATGTTAAAAAATATTTTTAAAATTTTTTATTAA
TCAATCAATATTGAAAACATATCAATTACTTATAATAAAATGGATAATATCATCACGGGA
AAATCATTTTCATATAGAGATTGGGATATTTCTGAATATTTTAAAAATTGTTTAGATGAT
ACTGTACCTAGTTGTACCAATGTCTGTTCAAATTTTGATAATGTAATAGTAAGTTCAAAC
ACAATATCCAAGCTATTAATAGCGGATATTCCAAAGATTGATAAATCTATTTCGTGTGCA
TATTCAGATGATAAAAAATCAACCGTAGAACTTAATAGAGTGTCTAGATTTGGAAAACTA
ATATTATTAAATAATGAAAAAAATGTTGTCTATATTACTGGTACAAATAATAATGTAGTT
TATGTAATATTAACATTAATGAGAAACAATGACTGCGATAAGGGTTCTTGTGAAATAAAA
ATATTAAAAGATAATGATGAAGATAATATCTCTAGATTACTCGACGAACAACGATTTGCT
ATTATTCAAGGAAACCAAGATGCGCTGGTTAGTGGAAACAATATATTAATATTAATATTG
ATCTTCGATGAAAAAAATTTTCCCTTTATACCACTTATACGATCTATATCAAATAATGAT
GTATTTATTTCTAGACACAATAGAATTCATGAGGAGATTCCCGATAAAAACTGGTTTAAA
TTTTATGTTGAGTTACGGCATTGTTATACGACATCCCTTATGTTGGTTATAGATGGTACT
GTATTGTATGTTGGAACGGATAAAGATACACATTGTTTAATAAGTAAAGGGAGGGCTAAT
AAGCAAGAGGCTATAGATGATTGTCATTGCTGTTATAACGATGTATCATTATGTGTCTTT
GATAAAAGAGAACTTTTACAAAAAACAATATGTTCTTCAATTAGGGGAGGCTTACATATC
ATTATTAAAACTATAGGTAATTTTAGCGCTGGCGCTGTAGGTATTATTCCAAAATTTGAT
TATATAAAAATTACAATGTCTGCAGCGTGTATTATGTTAACTAAGGATGATAAATTATCT
GGAAAAACGAATATTGGTTCCTATATTTATGGTATCGCTCATAGATAAAAAAAATTAATT
AATTAATTTATTGTAATGCATTAATAAAATTTTCATTTATTAATTTTTTTATTAATATAT
ATTCGCTATTAAGATTATGTATTGTACTTACCATATTGTTTAAAGTAGAATTATTGTAAT
AGTGAATAGGGGTATAAGAATTATCTGGATATCCAAAACCTACAATCGAAACAGAATTAC
ACATATATAATGACATAATAATTGCAAGTATTCCAGTAGTGGGTACTGGCTCTGTCTCTT
TTTTAGATACGTCTTTTAAGAGGTTCATGGCCGTGTAGGCAAAATATGGATTTAATATTC
TAATTTGTTTTTTATCAATATCCCATGTTTTAATTGGAGGCTTCCAAAAAAGTCTAGGAT
TAATCCTCCTTTTATTGAGTATGTTATATAACCAATATAAATCACCTTTTTTAAACGGTA
TCATGACGAATAATGTATCCTTTTGATTCTCGATTTTTGCATTTTCTTGTGCGGATTCGG
GATAAAACAATCTTATGGTAGTTATGTTTCCGACATCTTCTTCAAAATTATGTATAGGCG
CATCATTTATTCTTATTACAATATTGTGTGAATTTATTTTATGACCTAGTTTACTATTAA
CCAAATTATGACTATTACCCACAACGATACATTTTTTACAACGAATATGTTTAATATGTG
TTGGAATATCTGTAACATTTGCTATAGATAGAAGATTATTTATTTGATGTTCAACTCCTA
ATAAACCATATGGTAAATTTTTTTTATTGATATGTGTAATTAATTTTTTATTTAAAAATA
TAAAATCATAATCAACATAAAAGGATTCCATACATTCAGAAATAGTATATAATGTTTTAT
ATATATGAGATAATATAAATAGTATAATCAATAAGATTAGTATATATAATTCTTTTTTGT
TTATACGGATTCTCATTTTATTATTTATACATTTTCTTGTATATATTTTCAGAAAAAGGA
TAGAATTTGTAAGCGATTGCTGCAATTAAAAGTAGCATTATTATTAATATGGGAATAATA
AGGAATATTATATTTATATCTTTTTCTATGTATGCAGTTACTTCAAAATGATAATTATTA
TGATATACATGACATGTGTATTTTAATTCTATAGGACTACTATCTAAACTTATTGAGGAC
CAAGATTCATAATTATAATTTTTATATGGAACAGAATCAGTAATATTTTTTATATTTATT
TTATCCCAATGTATTGCGATTTGTTTTGGAAAATATCCTAATGCATAGCAGGTCAATACA
AATGTATCATTAACTATATGTTTATATATGAGTATAGTAGGTTTCTTCTTATATTCAATG
ATATCTTTTTTATTAGTTAGGTAATCCATTAATTTGTACCTACATTGATCATTTATAAAT
GTTCTTATTGAATACATAAATAGATCATTATTAATCTTAATAATAGTCATATTTTTGGTA
CATGTTATCGATGATCTATTATGACAGATGATGTTAAAATAATCATTATTATATAAATAA
TTATTATACCCACCTCCGCCAAGTTTGCATGACATAACAAATTGTAATACATTTTTATAT
TTATCCAATTTTTTATTTTGTTCTATAGTTACATATTGTATTAAATACAAAATTAATTGA
TTTAATCCATAAGGAATATGACCATGTAATTCTTTTTCTATATCTGATTCAGTGTTATTC
TCCAAAAAAGTTTTAGTAAAAGAATTTAATAATGTATCCTCATTAACAATTTCCACAAAG
GAAAAAATAGTATTGTTATTATTGTCTATATATATTGTATATTGATGTGTCAATGTACTA
TCATCATTTTGATCATATGATAAGATGATGTATGGAATAGTGAATATAAGAAAAACAACG
AACATCATATTGATATTCATTGTTGAAATTAATCAATCTGTATTATTTTTCAAAAAAAAA
TAAAAAAACATACATTTTAGTTCATATAAATGTTGTTCACCTACAAATCATGGCTAATTA
CATTAACTTTAATGTGTCGATATTAACTGATAAAATTGTTATCAATGTAGATAATACCAA
TTTACCAGTTATTGTCTTTACAGGATCTGAAATTCAATATAAATCAAGATGTTCAAATAA
CTTTATATTGAGAGATTCTATTACAGACGATGATGACATAATGATCATATTAAAGAACTA
TTTATGGTATAGAGGCTTTATAGGACTAGTAAATATGCGCTATGGTAGAGTATTTAAAGA
ATTGAGATCGTTCGATAATGATGCAGTGAGTAAATATGGTTCTGTCGATAAAATATTCTC
AATGTTAAATCTTAATTCTGAGGATGGGGTAAAAAATTTCAAAAATTTTATGAAATTACA
GAAAGATATTTTAAGCAAAAATATTGATGTATATAGCTGTATTGAAATAATAGGATTATG
TGCTATGGTTGCGGAACAATGGAAACGCAATAAAAATTGTTTAAATTGGTCAGCCGTCGT
CGATGAGATGTTGAAGATTATCCATCCCAATTTGGAACAAATAAAATATCTATTGCAGGA
TAGACTTGTATATGAAGAATTATTTTAATTATAATTTTTTTACACCTTTTAAAAAATACA
AATATAAAGCAAAAAATATAGATGGCTTTATTTTTTAAACTCGTTAATTTATTTATTATA
ATTAAGTATGTACACGCTATTCATTGTGTTCATAATATAACAACTAAACCGTATAAAGAT
GTATATCTTTCTTGTAATAAAACAATATCTTTTGATTCTATATTAATAACGTGGAAAAAG
AATAATCAATCTATATTATATTATGGGACTATGGGTCCCATAGTCGTGGATAAGTTTAAA
ACTAAAATTAAGTATATGTCAGATACATTTAATAAATCAATAATATTGATTAAGAATGTT
TCAGAAAGCGATAATGGCTGTTACGAATGTACGTTTAATACTTTAAACATTAAATTTAAT
GATAAAGGTGTTATTTGTGTAAATGTAAGCGATGAAGTATATACCGACGATATTACTATT
AATTCTAATTCTTTTACGACAAAAGGTAATAATATATTGACGACCACTTTATATGACGAC
CCATCTTCTATACAATATATAAATTATACTAATAATGGTAATAGAAATGGGATAAGTATA
TATCAATATTTAAAAGTTTTTTTAGCGTTATTAATGTTATTATAAAAAGTGATTTTATAT
AATAAAAATCATAAAATTATGCCTAAAAAAATTAATAATGAAATGTTTGATGAAGGCGAA
ACATTAACAGATAATACCGGAAGACGATGGAAACTTGGAAATATAATAGGTAAAGGAGGG
TTCGGTTTTATATATTTATCTTTTCTATATATTGATGATACACACATCGATACAGAAGAA
AGATATGTAATAAAGATAGAACCCAAAAGTAATGGACCATTATTCGTGGAACAAATATTT
TATCAAAGAATATGCAAAAAGGAGCTAATAGAAAAGTGGTTAAAGGAAAATAATATCCAA
TATATAGGTATTCCTACATTTTATGGATTTGGATTTTGTAAAAAAAATAAAATAGAATAT
AGATTTATAATTATAGATAGATTAGGTTGTGATTTGAATAAAATCATTAGTGTTAATAAC
AATAAACTTCCTGTTAGGTCTGTATTCCTAATAGCTATAAATATAATAAATACATTAAAA
TATTTACATAATAACGGATATACACACAGTGATATAAAATCATCTAATATAGCTATTGGG
TTACATGATAAAAACAAAATTTACTTGTTAGATTACGGATTATCATATAGATATATGATT
AATGGTAAACATGTTGAATATAAAAGAGACCCTAAAAAGATGCATAATGGAACCATAGAA
TTTACTAGCATCGATATGCATCGTGGAGCATGCCCTTCTAGGCGAGGAGATTTAGAAATA
TTGGGTTATTGTATGATTACTTGGTTAGGTGGTAAATTACCATGGGAGGATAATTTAAAA
AATTGTAATTATGTAATGAATTCAAAAGTAGACCATTTAAAAGACGTAAGATTATTTATT
GAAAAATGTTTGGGCGATAATTATCCTAAAAAATTATTAGATTATTTTATCTATATAAAC
TCTCTCGAATATGACTCCACCCCTGATTATAAAAAACTTATATCATTTTTATCTGTAAAA
ACATAAAAATCAAATAACGTAATTAAATGAGCCAGGATTATGATATTAATGATTTTATAA
AATTAAAATGTGATGATATCGATATTATTATATTAATTGTTAATAGATATATTAATATTA
CTAAATTATGTAATCCAATGAAGAAACCATTTTATTCATGGTGGAATTCAGTAAAAAATA
GACAAATTATCATCAACACAGCTATTGAAGAATGCGTTAAAGTGGATAAATTATTATACC
GTATTTATAAAAGTAAATCTACAAAAACCATATATGGCGTATATATTCATTATAGATTAT
TGGAATATATATTAAATTGGATATCTAATGATTATTGTATAAAAATACTTAATACGATTA
ACAATTTTAATGCGGATATTTTAAAAAGTAAAAAAGATAACGACAATATTAAACACATAT
ATAATAGACTTAAATATGAAGAAAATATGTATTACGCAATATTAAATAAAAATGATACGA
AGAAAAAAAATTATAAAAAATTTAAAAATACAATTCCTTTAATTTTATATGATTTTGAAG
AAGATTATGAGTTATCAAAAACGAAAGAATGCAATATATGTATGGAAAATATATATGATA
AAGAAAAAATATATAATAGATATTTTGGCATAATATCGTCTTGTAATCATGTTTTCTGTA
TGGGATGTATAACTATTTGGAGAAAAAATAAAACAACGTGTCCTTTATGTAGGAAAAAAT
TTATTTTTGTAATTAAGAGTAGATTTTTCAGAAAAATCAAATAAATAAAGCTTAAAAAAT
AGTCAATAAATATAAACAAAAATATATCGTCACATCATAAAATATAGTCTAATAAATAAT
TATGAAAATAATATTATATTTATTTATAGGAGTATGTTACGTTCACGGTGTAAAATCCAT
ATATTGCGACAAACCAGACGATATAAGCAATGGTTTTATTACAGAGTTAATGGAAAAATA
TGAAGTTGGAAAACTAATAGAATATACATGCAATACAGGTTACGCATTAATTGGGGATAG
ATTTAGAACATGTGTTAAAGATAAAAATAATGCCATATGGAGTAATAAAGCACCATTTTG
TATGCTTAAAGAATGTAACGATCCTCCATCCATAATTAATGGAAAAATTTATAATAAAAG
GGAAATGTATAAAGTAGGAGATGAAATTTATTATGTATGTAATGAACATAGAGGAGTACA
ATATTCACTCGTCGGTAATGAAAAAATCACATGCATACAAGACAAAAGTTGGAAACCTGA
TCCTCCCATATGTAAAATGATTAATTGTAGGTTTCCAGCTCTTCAAAATGGATACATTAA
TGGAATTCCATCTAATAAAAAATTTTATTATAAGACAAGAGTTGGTTTTTCGTGTAAATC
AGGTTTTGACCTGGTAGGTGAAAAATATTCTACTTGTAATATAAATGCGACATGGTTTCC
TAGTATTCCAACGTGTGTACGAAATAAACCAATAGATGATATAATTTATCTTAAACCAGT
AGATGATAATTTTGATGATTTGGATAACGAGGATAAAATAAATACTATATTACATAATAA
CGATGCTAATTCAACCAGGATAAATCAAGAAAAAGAAAACGGTAATATTTTTACCGTGAT
TATACTACTTAGTATTATATCATTTATGTTTATTCTTGGAGTATTGTCATTGTTATGTTC
ATGTATGTTAAAATCATCTTCAAAAACATCAGTGTATAATAAATTATAAATTAATATTCA
TTTGATATTTTTCTACAATGGACGAATTTATTTATATAGATACTACTGTGGAAAAAAATA
TTGTAGATATTTTAAAATATTATATTACTTGGAGGGGATCATCAGATTTTTATGATAAAC
ATGACTGTGGTAAAATATTTAAAAAGCTTATGTTGTTCGACGATAACGCAAGAAAGATAA
TGGGTGATTACGATTATTTATTTATTAAAAACATGAACCTATCATTGGACGATGGTCCTA
GATTAGATAAAATTGATAGTAATATATTATCGAAATTGTCATATAAAGAACTAATTGGTG
TATGTGCAGTTTTAGCTGAAAAGGTTGTACACTATCCATATACTATCAAGTGGGAGAAAG
TATTTAATACATTATTTAATAGACTAACAAATGAAGACTTGATGGAAATAAAAACATTTT
TAAATAAAACATAAAATAAAAATTGTGTATTGAAACAACTAACATGGAACATATAATAAA
TAATAAATCATCATTTTGGAATATCGTGAAGAAGAAAAAGGATGACAATAACATTACAAA
GGCAGAATCTTATATCGATAGAAAATGTATTAATAAAATAAAATATATTAATTCAGAAGA
TATAGATAAAGAAAATATATTTGTCATTAAGGAAAATGAACAAAATATCATACAAACTGG
TATATTTAATGATAAAAAGGTTATAATAAGATCATTTAAAAAGTTTCAAAAAGGTCATAA
AGTATTATCCGATATATGTGAAAATGAAATAGAGAATATGAAAAAAATAGATGCGTATAA
TATTTTAAAAATTTATGGATTTTTCATAGATATAATAGATGAATTACCTAGAGTTTCTTT
ATTATTAGAATTTTGCGATAGAGGATATCTAAGAGAGGTATTAAATTATGAACAATCATT
AAGCTTGCAAACTAGAGTTGATATGGCGATAGATTGTTGTATGTCATTATATAATCTTTA
TAAATATATTAATAGACCTTATAAGCATATAACAAGCGTTAATTTTTTGGTTAAGGAAAA
TTATAAAATAAAATTAATAGGACATGGTTTGGAAAAATTATTATCATCCCCTGCATTTAA
AAATATCAACGATGTAGTATACAAATCTCCAAAATTATTAAATAATATATTTGAAACATT
GTCAATAGAAGATGATATTTATAGTTTAGGAATTGTTTTATGGGAAATTTTTACAGGGAA
TATACCATTTGATGGATTAAATACAAAAGAAATATACGATTTAATATTATTAAATAATTA
TTCGTTTAAAGTTGATAATTGTCCACAAATTATTAATTGTGTTATAGAAAGATGTACAAA
TCATGATGCGATTAAAAGGCCAACTGTAAAAGAAATATTATATAATTTATCATTATATAA
GTTTTATTATGATTAAAATAGAAAAAACATATATATTCATAATAAATGGAAAATAATCCA
TTTAACAAACGTATTCATGATTTTAGTGATTATGATAATGCAGAAAAATATGATAGATTT
TTAGATCATTATCAAATTAATGGATTTTTACAATATTATTTGTTATGGAGATCAAATATA
AGGCAAGAAGATAACATTGGAAAAATATTTAAAGAATTTTTAAAATATGATCATTTAGCT
AGATGGAGATTTTCAGAAAAAGATTTTAACGATGCTAAAGATCTGTTGATAAAAAACGAT
AGAAATACTTCCTATATCTTAAAAATTCCTGAATCTAATGATATTGATTTATTGATAGAT
ATAAAAGAGGTATTGGGATTTTTAGCAATTTTATTAGAGGAGATTAAGTTGGATATTAAC
TTCTTTGCTGTATTCAACGTAATTAATTCATTCTCAAAATATGTTAATCAAGAAACATTA
GAAATCCTTAAATTAGAATTACAATATCTATATCCATAATATATATAATAAATTGAAAAT
AAACCAATTTTTATTAATATATAAAATGTATTCATTTTACGAGTTGCAGAAATTTTGTGA
TATAACAATAATAGTTAATGGAAAAAAAAAAATAAATGCTCATAAAATAATTTTATCCTC
TATGTCAAAATATTTTGATATTATGTTTAGTGGAAATTTTATCGAGAATAAGATGAAAGA
AATAAATATTATATTAGATATAGAAAATTATGAATCTTTTGATGAAGTTATCAAGTTTAT
GTATGTTAGGAGATTTAATTATTATATAAATGATTATAATATTTTAAAGGATATGTTAAT
TTTGGCAAATTATTTTATTATAGATGAATTAATAAACCCATGTATAAATGCCCTTATAAG
AATATCTGATTTACGTAATTGTATAGATTTATATAAATTTTCTGAACTTTATAATTATAA
AAGATTAACAATATTTTCATATAATCATATTAAAAATAATATAAAAATTATATATAAGTA
TTGCAATTTTGGAAATTTGGAAACTAATGATATTATAAAATTGCTTTCTGATAAAAAAAT
TATAGTCGAATCAGAGGAAGATATCGTCGAAATATTATTAACATGGCTTAATTTTAAACA
AGATATAAATAGATTTGACTTATATAATTTGATTAAGAAGGTAAGAATTTCTTTATTAAA
TTTTGATTCAATTGCAAAATTAAAAACTCATCCCTTAATTATAAATAATAATAGGTGTAT
TTCTATTCTTAATTCAAAAACAAAAATATCCCAACCTAGATATTCTACGCTTGGATCATT
GATATATATTACAGATCCAGATAAGTTTGTAAATGATGGACAACTCTATATGAATATCTG
TACTTATAATTTTGTAACTGATGAAATAAAAACAATAGATACCATTCCATACGCTTATGA
TTTTAACTCATTATTTTATAATGATGTATTTTATTTTACAAAGTTTATTTGTAGAAACGG
AAGAGTATTAACAGATAAAAGTTTTCATAGTTATGATTTATTAACAAAGCAATGGAATAA
ATTTCCAGAGTTAATTAATAATAGAAATTATGCAACTACAATTTGTGATGGTAAATTATT
TTCAATAGGTGGAATTTTAAACGGCGAATATATAAGTGATGTAAAATATTGGCGTATTGG
TGAAAATATTTGGACAAATTCAATACCTATTAAAATACCAAGATCAAATCTATTTTTAGC
CATCTATGATGGAGAAATTTATGCACTAGGAGGAAAAAATGGCGAATTATTAGACATTGT
AGAAAAATTCGATAAAAATGAGATGAAATGGATAACCTTAGCACCATTACCTATACCACT
TATCGATGGATCTGCTATTATTCATGATGGGTTTATATACGTAATAGGTGGAACTTCATA
TATAGATTTACCTTATGATATTGATCCAACTAATGGTGCTAGCAAAAATATGTTCAGATA
TGATATAGTAAAAAATACTTGGTCCAGGTTGTCTTCATCTAATTTTAATAAAATTAATGC
TAGCTTAACTATTATAAACTGCAAGATATATGTAGTTGGTGGTGACAAAAATAATTATAT
AGAGGTTTATGATATCAAAAAAGATGAATGGTCATTATTTAGAAAATCCTATTGTACATC
CTACTCAAGACAGATGAACATTTTTACAAAAAAAATTTTTATTTAATGTCAAAGAACTGT
TTTCATAAAAAAGGAAATAATAACAAGATACTAGTGGATCGGAATAAAAATGTTCCCACT
TTATGATTATATCGTCTTTACTAAGTCAAAAACAATAAAATATAAAAATGTATTAAAACT
TATTGAAAGTGATAAATCAATATTGGATGACTATAAAAGCAAATACTATATATTATGTGA
ATATCTTTATAAGAAATATATAAACATTGATGTATTAAATTTATTAATCAATACAGGCAT
ACCCGTTAAAACAAATAACTTAATAAATTTCTGTTTGTCTAGTTTCTTTGCAAACACTAA
AATAAAATTTAATATTAATCATGTAAAGGAAATTATAGAAATTCTAATAAAAAATGGAGC
CACTTTTAAAAGGAAACCATATTCTACACATCCACTTTTTTACCTTATTTGTAATAAAAA
ATTTAATTATAGCTCTTTATATGAATATTTAACAAAATATAATATAAATTTTAATATAAA
AAATCCAGATGGATTTAATTTATTACATATGTATTTAGATCAAATAGAGGATGTAAAGTT
AGATGTTATTAAAACACTATTATCTAATAAAGTAAAGATCAATGCAAAAACAAGATTCAA
TAGGCTGACTCCCTTACAGATATATCTTCAAAAAAATTTTATACAGGAAAAGGTTATTAA
TTTTTTAATAGATAATGGATCAGAAATCAATAGTGGTTTCATCGAAACTCCATTATATAC
ATTATTAAATAATTGTAATTCCAATAAAAAATTAAAAAGTTTAACGACAAAATTTATAAA
AAAAGGTGCCGATATAAACCAACGGGCGGAAAATGATGGAAGAACACCAATAGTTGGATT
TATACTCAATAGTGCTATAATTAATGTAGATAATTTAAAATTCTTATTAGATAATGGTGC
AAATCCTCTTGTGACAATTAGGGGGAATAATAATTTATTACATTTATATTTAGAAAGATA
TAATGTATCAATAAGTATACTATCAATATTATTGGATAGTGGTATAGATATCAATGCTTT
TAACTACCAAAATCATAGACCTATACATGTATATTTAGATAAAGAAGCTGAAGATATATA
TATCATAATAATAGAATTCCTATTGTCAAAAGGCGCCACATTATCCAGAGTAAATGATTC
TAATAGATTTTCAGAATCCATTTTAGAAGTTTTCCTAAGAAATAATAAAGATATAACTGT
CTCTACATTAACGGTTGTCAATTATTTACTTAAATTATTTCCCATAGATAGCATAGATGA
ATATGGATATAACCCTCTTTTATCCTCGGTATATACATATAATGTTGAGTTTTTTAATTA
TTTCATTGATTTGGGTGCGGATATAAATATAATATCAAAAATGGGTGATACATGCTCTTC
TATAGCAATTATTAAAGAATATAAATGTATTTTTAATCTATTATTAAAATGTACAGATAT
ATCGGATGATCACATAATACAAACAATTAAATATTTAGAAGATAAAAATTTTGATACACA
TATTAAGATTAAAATGATGGAACGATATATTCGTTTTATGTTCAATAAAAATCCAGATAT
ATATTTAAAATATAAATATTTATCATTAAAATTTGGTGATACCATAGATGAATGTTTAAA
AGATTTAATAAACATGAAAAATACATATTTGAGAAAAACGACAGTATTTAATCTAATATT
TAATAAAAATAATACTATGCCAATAGGTTATATATTCTCAAATAATGTTACACAATATTT
AACTTCAAAAATATATGGGGAAAAAGTGAAAAGGGTTATTGAAAATTCATTGAAAAGATA
CAGTCATATAAATACAATATTAAAAAGAATTAATAGTGAATGTGGGGAAAATAATAATAT
TTGGAATATCCTACCAGATGAAATGAAATTGAAGATTTTGGATTCATTAACATTAGATGA
TTTATTGAAATTAATGATTCTATTCAAAAAGAGAAAAACTTTACTGTTTTTATAAAATAT
GTAGAAAAAAATGTAAAAAAAATATTGAACTATTGTGTGGAGTTATTTGTTTTAATCATT
GATAAAATGGATAACTCATCTACTACTTTATCATCTACTACTTTATCATCTACTACTTTA
TCATCTACTACTTTATCTACTATAGAAACATCTATGGATGAATCTACATCGATAATATCA
ACTATTACTACAATAATTCCAACAATAATTCCAACGTCGCAATCATCATCATCATCATCA
TCATCATCATCATCATCATCATCATCATCATCATCAATTACATATGATTATGAATATTAT
AATAATATAACTTATGAATTAATTAATATAAAAAATATGTGTATGTATCCAAGTATAACT
GAATATATTAGAATTTTTTACATTATAATATTCATATTGGGATTATTTGGAAATGCAATG
ATAATAATGATTTTATTTCATAAAAAAATAAAAACAATCACGGATATCTATATATTCAAT
TTAGCAATTTCTGATTTAATATTTGTTATAGATTTCCCATTCATAATCTATAATGAGTTT
GATCAATGGATATTTGGTGATTTTATGTGTAAAGTAATTTCTGTATCTTATTATATAGGA
TTTTTTAGTAATATGTTTTTGATTACATTAATGAGTATAGATAGATATTTTGCAATTTTA
TATCCAATAAGTTTTCAAAAATATAGAACATTTAATATTGGATTAATATTATGCATTATT
ACATGGTCATTATCATTATTGATAACATCTCCAACTTATTTTATATTTGAATCAAGTAAT
ATGATATATAGTAAACAGGATTCAAATGAAACAATATCAAATTATCAATGTACTGTTATA
GAGGAAAGAGAAAATACCAATATTTCATTTCTTAAAAGGATGTTACAATTTGAAATTAAT
ATATTGGGAATGCTTATTCCTATAATTATCTTTGCTTTCTGTTATATAAAAATTATTTTA
AAATTAAAACAATTAAAAAAATCCAAAACGAAATCTATAAGGATAGTATCAATAATCATT
GTATGTTCATTAATTTGTTGGATACCATTAAACATTGTTATTTTAATTGCTACAGTTTAT
AGTATGCAGAGTTTTAATTCGATAATTAGTGAAAATATTTGTAATTTCATTAAAGTTGGA
TACGCTATGATGTTAACAGAGGCCATTTCATTAACACATTGTTGTATAAATCCATTAATA
TATACATTGATTGGTGAAAATTTTAGAATGCATCTTTTAATGATTTTTAGAAATCTATTT
ACAAATACAAAATTCTCTTTTCGTAAATCATCTATAAGTAGTAGTATTATTTTTTAAAAA
TAGTTGATTTATTATTAAATATAAATAATGATAAACATTTTTTTTTTTCATATTTGATTG
TTATTGTTATTATTTCAACATCATCTATAGATGAAAAAAATAAATATATGCAGGAATTAT
TCAATAATCGTAAAAAAGAAATATCAGATCTCATATTAAATAAATTAAATTTAAAAAATA
TACCCACATTGCCACAATCTGATATATTTCCAAGTATTGATATAATAAATTTATATAATG
AATCTGTTAATATATTTGGAGATGATAAATATGAAGAAATAGATTATTCTACAGAATTTG
AAACATTATTACCGAAAACATATAAAATAACTGAAGATGGATATTCATGTATTGATTTTG
ATATGACTAATATTCGTATTGAAACAAATAGAGATAGTTCAAGAATATTGAAATCATTAT
TGATATTAGATTTTTATGAATTATTAATAGAAAATCAAAAAATATTAGTTTTTAAACGAT
CATCAACAACAGGTAATTTTTTATATTCACAAGATGGCCTTAAAGATCCAGCAACTGATA
AAATTATTTTCAATATTTATAATTTTATGTCTTCATCCATAAACCATGAAACAAATTTAT
TGATGTTTTGTTTTGTATTAAGAGTTAATAAAAAAAGTATAAATGAACGCATTCAAGATA
TGGCAAAATTAAATATAAGTAATATCAATAATCCACATATATTACTTTTAAAAAAAAAAA
ATAATAATATTAGAACTGTTAGGCATGTTATGGACTCATGCGAATTATCATCTACATGTT
GTTTAGTAGATTTTTATATAGATTTTAAAAAAGATATGGGTTGGAATTGGATTTATAAAC
CAGAAGGATACCATGCTAATTTATGTATAGGAAATTGTAATCATAAATTAATTAATATGC
CATATAATTATGCATTTAAACATAATGTATTTTGTTGTGCACCAAAAAAGATGAAATCAT
TAATTATTGCATATTATGAAGGACGTAAATATAAGGTTGATAACTTAAAAAATATGAAAA
TTGTTTCATGTGGTTGTTGAATATATTGGATAATGAAAAAATAGGTATATATTTAATAGG
AGGTGATATTGGATTATTCAAATATGTCATCTTTATACGAATATATCGCTTATTCAAAGA
ATATAAAACAAAAAACATTGAAGTTTCTATTTAAATGTGGTTATGATGTGAATGAAGTAT
ATAGGGGTAACAATATTTTGCTTAGATATTTGAAAAGACATGACATAAAACCAAATATAG
TTCAATTATTAATTGATAATGGTGCAGATATTAATTACAAGGGATTAATAGAAACACCAC
TATGTGCCTTTTTAAATAACAGAGAAATAACGGATATAAAAAAATATAAGAAAATATTAA
AAATTTTATTGGATTATGGTATAGATACTAATTTAAAAACTATAAACGGAATATCGCCCA
TAGTATGCTTTATATATAATTCTACAATAAATAATTCAGAAATATTAAGATTATTATTAT
CAAAAGGATTAGATATAAATGAAGTAAAAAATTTAAGTGGTTATAATGTATTACATATGT
ATCTTGAAAATCCATCAATATCCAAAGATGTTATAAATATATTAATAAATTCGGGCATAG
ATATTTTAGAAAAAACTATATTATTTCATTTAGCACCGATAAATGTCTATATCAGAAATG
ATATCAACAATATATCAATTGATATGATGAAATTTCTCATCAAAAATGGTTGTAAAATAG
AAAATAATGATTTTATATTATCAGAATCTGTTCTTGATTCATTTCTTGATACTCATAAAG
CGTTGTATAAAAAGGAGATGAAAATTTTAAATTTTATTTTAAAATATATAAAGATAAATG
TAAAAGATAAATTTGGTTTTAATCCATTACTATCGTCAGCAAAATATGATAATTATGAAG
CGTTTAAATATTTATTAAATCTAGGAGATGATATAAATTCTGTATCATCAGATGGAGATA
CATGTGCTACATTTGCTATAAAACATGGAAATATATTAATGCTTAATCATATATTAGGAT
TAAAACCAAATAATAATTTTATAAAAAATACATTTAATTATTTTTCAAAAAATAATATAG
ATGATGTATTTTATAGTAGTAAAAAATATATCATGATGATGGTATTGATGGAATATTCAT
TTACCATATATCCAACATTTTATAAAAATTGTGCTGATATAATAGTTGCATATTCAGATT
TTATATCAAGATGTGAGAAAGATTTAAATATTATGAAGAAAGAATTTGTAAGTAAAAATC
TTTCTGTTTATGATTTAGTCTTTAATAACAAAAATGATATCATACCGTTTAAATTTTTGA
CTTGTAAAAACTTAACAAAATTTAAATTTTCTATATTGTATGGAAATAAAATTAATGCAT
TAATATATGAGTCTTGGCAACATTATAAATATAAAAATAAAGTTAATGATGTTCTTGAGA
AATATTGTAATAAGAATAATTATTGGATGAAAATACCAATAGAAATTCGATTATTAATTT
TGGATTTCTTAACAGTCAATGATTTTAAAAGAATAATAAAATTTGATAAATCTATACTCA
ATAGGTTCCGTAGTCAAATATTGAAATAGTACCTTTTTCTTTTAATGAGAGATATTTTTT
TTAACAAATGTCTCTTTTATACAACTATATATGTACTTCAAAAACCATCGATATTTCTAT
TGTAAAATATTATATAGAGAATGATGATATTAAAAAGCACATCGATGAGAATGATATGAT
GCAAGTCTATCTAAGAAGATCTGATATCACGTTTAAAGTATTTAAATTGTTAGTAGCATA
TGGTGGTAATTTACATTTTGATAAAGGAATTTTAGATTCTCCTCTTTCAACATTTTTGGC
AAATAAACATATAAAATATATACCCTCTAAGGATGTAAAAAAAATAATAAAGTTAATGCT
AAACAAAGGCATAGATATAAATAAAATCTCTAGATATGGCCTTAGTCCTTTTATGTACTA
CATAAGAAATCAAATAATAAAAATTGACATGTTAAATTTTTTAATAAAAAATGGAGCGGA
CATTACTAAAAAAATAAAAAATGGGAATAATATATTACAAATATATTTAAGTAACGATTC
TGTAAATTTTAAAATAGTAAAATATCTTATAGAAATGGGATTAGATCCTGGGGAAAAAAA
TAAAAATGGATGTAATTCAATAGATATATTCATTAGGAATAATAATTGTAATTGTGATAT
GAGTATTTTAAATTTATTGTTTTTAAAGATAAATTATGATATATATAAAAAATCGGATAT
TTATATGTCTGCATTAGATATATTTTTGGAATATAGTGATGAAGATTCGGATTATATAAA
ATCTTTAAATGTAATAAATTTTATTCTTTCAAACATTTCAATTAATGAAAGAGATAGATT
TGGAAAAACTCCTATAATGTATGCTACATGTAATAAAACATTTTTTAGATATTTTATTAA
GTTAGGATCTGATATAAATGTATATTCTGATGATGGAACCACATGTGGTTCATTAGCGAT
AATAAATTGTGATGATTATATATTTGATACATTTATCCATTCTAATCTTAGTTTAGAAAC
TATAGAAAAAACATTTGAAAATGTATTTTCAAAACATTTATACGCTATTTTAAACTGCAA
TACAAAAATTAAAATGATAAAAAAATTAATAGTCAAAACTTTTATGTTAGATCCATTATT
TTATAATAGATTTGATGTGTTAGATAAATATTTTAAATCATTTATCGATAAATATAAAAA
ACCAATTGAGAATATGTGCAATGATAAAATAAAAGGCTTATCAGTGTATGATATAATTTT
TGGTAACAATGAAATAAGCATGAATATAATCTATACAACTAATTGTTTGATTACAAAATA
TATCAACAGTGAATACAAAAAATGGGTAATAAAGGCAATTGAAAATTCTAAAAAACGAAA
ATTTGATATAGATGAAATATTAATGTACATATACAACAGTTATTATTTATCATCGTTACC
GATAGAATTACAAATGAAGATTATAGACTTATTGGATGATAAAACATTAAGGAAATTAAA
ACATGTACTAAAATATTAACATTGAAAAATAAGTTAATGATTTGCAAACGAAAGTTTTTT
TTAACAACCATGGCAGTTAGTAATTTGTATAAATATGTAACCTATTCAGATGTGGTTATC
TTTAAAACTGTAAAATTACTCATAGGGACGTATAATCCCAGTGAAACACATAAACAATTT
TCTATATTTCAGAGATATTTACAACGTCCGAACTTGTCCACCAAAATAATCAAATTATTC
ATAAAACATGGAGCAGATGTTGACGGATTAGATGCGGAGATGTCTACTCCATTATGTACT
ATATTAACAAATATAAAAGATTATAAAACTAAACCATTGAATATTATTTTATTATTTATC
GAAAATGGTGCAAACATAAACAAAAAAACTTTAGACGGAAATAATCCATTATGTTGTATG
TTATCAAATAAATATATAAACTCACTTGAAAATATAATATTTATGATAGAAAATGGAGCG
GATGTTTTTGCAAATGATAATAAAAATTTTAATACATTACAAGTATATTTACAATCCGGA
TGTAATATAGATATAAATGTTATAAAATTATTACTCGATAAAGGTGTTAATATAAATCAA
CATAATAATGAATATGGATATACTTCATTACATTGTTATTTTAAAACAAATGTAAGTTGT
TTAGATGTAGATATTGCAAAATTTTTAATTGACAATGGATTAATTATTAATAAATTTAAT
AAACAAAATAGAAAAAATTTTATTTATGTGATAGATTTGCTCATACTCAATAAAAAATTT
AATAAAGACATATTTGATCTTATATTTTCATATATAGATATAAATGATTATGATGTTTTA
AACATTAATCCAATATACTATTCAATTTATTATAATAATAAAAAAGCTTTTAGATACCTA
TTAAATGCTGGAGGAGATATAAATATCGTTACTAGTCTTGGTAATACTTGCTTATATACA
GCATTTGAAAATGAAAGTAAATACATGTTTAACTCTATTTTAAATTCTTTTCCCAATAAC
AATGTAATGGAACAAACATTTTATAGACTTAATACATATGTATCTAATAAGGAAAATACT
ACATTTGATGAATTAGAATTATTATTAATAAGAAAATGTATAGCATATTTCATATTATAT
AATAAAGACTATAATATAAAACTTTATTATCCGTATATTTTTACACATTTCAAATATTTT
ATAAAATATTGTAAAAAAGTGATTGATGAATTATCTAATACATATGTGGAAAACATTTCC
ATATTTGATATATTTTTTAAATATAAAAAATTTAAAAGTGTTCCAATAAAGTATGTGAAA
AATAAAAAAATAATTGGTTATTCTCAATTGTTTTATTATGGAGAAATTATACAAAAGATT
TTAAATCTATCAAAACGCAGATATAATAATATCAATAAAACTATATTATTAATAACTAAA
ATATGTGACAATGAGTTAAATTATTGGAATTATTTACCAAACGAAATTAAATTTAAAATT
ATTGATAATTTGTCTAATAATGAAATACTGGAAACTTTTTTTTAAAAAAATAAATAGAAA
AATAATAAAAAATAAAGTAAATGGAAATTTTTAAAGATCTATTAAAACATAATCCTAATT
CTAATATTTTCTTTTCTCCTATATCTGTATCTTCTGCATTACATTTATTACTATTGGGTA
CAAATGGTGAAACAGCAAAACAAATTTCGTCTGTATTAGAACCTAAAAATGAAAACCTTA
AAAAACTTATTGTTGCAAATAGAATATATTGTGATTGGAGATTAAACATATTAACATCTT
TTATAGATAAAGTACGAGATGACTATGTGCTGGTAAACTTTGATCATAATCCCGAGAGCA
TAATAAATTTAATAAATGATTGGGTCAGAGAAAAAACAAATAATAAAATATGTAAAATAA
TAAATAATATAGGATTTAATACTAAACTATTAGTTGTAAACGCTACATATTTTAAATCTA
AATGGAGGGTTCCATTTTCAAGGTATAATACCCACCAAGCAAAATTTTGGAATAGTAACA
CTAATTATAAAAATGTATGTATGATGTACAACTTTGGCACATATGCCTTTTCATATATAA
AGGAATATAAGATAAAAGTTATAGAAATTCCATATGCGGATGATTATAGTATGGTAATAA
TATTGCCGGATGAAATAGATGGATTATATTATTTAGAAAATCAATTATCGACAAAAAATA
TTTTAAAATGGTTAGACACTACAAAACTAAAAGATGTTAATGTCATGATCCCTAAAATTA
AGATGGAAAAATATTACGATCTCAAGGATAATTTAAAAAGAATAGGTATTACAGATATAT
TTACGGATAATGCAAATTTTGAAAATATGACATCGACAGATCATAATAATATTTTCATAT
CAAAGTTTTGTCACAAAGCATGCATAGAAATTGATGAAGATGGGACAGAAGCAGCCGCAG
CAATAGGTATATGTGTCACTGATTGTGCATGTGTTTCTTATAAAGATTTCTATGCAACTC
GTCCATTTATATTTATCATTAAAGATGATAGTTCATTTTTATTTATGGGAAAATTTTATT
CTCCATAAATATATAAAATGATATCATATATTATAAATCCAATACTAAATATTTTTTATT
TTATGATAAGAAAAATTTCTGGGATAATATCTTTATTATTGATGAGAACGATTATCTTTC
TCTTTAAGTTAATTAATCCTTATCCAAACTTTCCAAATTTATTATCACCTATGAAAATGC
TATCTATAGATAGTTGGAATATATTTGGAGGAAAGCCACAGCCAAAAACTTCGGGATTCT
TAAGTTATTTGAACCCGTTTAAGAAGGAGGAACCTCCGAAAAAAGGATTTTTTTCAGGAC
TATTCGGATAAAAATGAATTTATACTCCATTTAATACGGCAGTCGATTCTGTTGCATCGC
ATCGAATCGAAATGGATAATACACTACTACTTCTTCTTTTAAATTTTATAGGATTGATTC
ATTATTCTAATTCTATAGCTATTCAAAGATGTAATGAAGATGAAGAAACAACATGGGAAA
TAGAGGTAGGGTTATGCATCACTACAATAGATGATTTTAAAGCCTCCAATACTGGATGTA
ACATGGTATACGGACCAGGAGGTCTAATAAAAGAGGGTAATGGGTTTAGAATTTTCATCC
ATGACGAATGTGATGACACAAATACGAATGAATTTATTGTAAAAAATGTAGATGAAGCAG
TATACGGATTAGGCAGATATGTATATACAGAAATGTACACCAGAAATTTGTCACATATAG
AACTAGCACCAAAATGTTCTAAAAAAATACACGTAATAGTGTCTTGTGATGAAGTGAGTA
GTGAATTAACATATAGACAAGAAAAGCATGAGTTTGGTGAAAGTGAGGTGGAAGTTACCA
TTAAAATAGATAATACGTGTATTCAACATAGTTCATCTTTGGTTCAAGTTAGATCGCTTT
GTGAAAAGAAATTGAAACCCGTCGCCTCTAAATACATCTTTTCAAGCAATATTGGGAAAT
TAACTTGTGGATTTGGGACGGTAGAAAATCATAATAAATATCTAAAACCTTGCCATCATG
GATCATTTGACAGATCGAAATATAATAAGCATCAACATGAACACATAAAGAAAATTTTTT
ATTATGATGAATTATAAATTTGATGAAAAAGTATTATATTTTAAATAATAATATAATGTT
GGATTTGGGGTTCTGTATCTTGAAATCCTTACACAGATTCAACATTGTTTTTTCTCCAGA
ATCGTTAAAAGCCTTCCTGCATGTATTATATTTAGGTTCTGAAAGAGAAACAAAAAATGA
ATTGAGTAAATATATAGGAAGCGCATATTCCCCTATACGGAAAAATCATATTCATAATAT
TACAAAAGTGTATGTGGATTCTCACCTACCTATACATTCCGCATTCGTAACATCTATGAA
TGATATGGGAATTGATGTGATACTCGCGGATCTCGCGAGTCACGCAGAACCTATACGGAG
ATCTATTAATGAATGGGTTTATAAAAAAACAAATATTGTTAACTTTTTACATTATATGCC
CGATACGTCTATTTTGATTATAAACACCGTACAGTTTAATGGATTATGGAAATATCCCTT
TTTACGTAAAAAAACTACGATGGATATCTTCAATATAGATAAGGTTTCCTTTAAATACGT
AAATATGATGACGACGAAAGGTATATTTAATGTGGGTAGATATCATCAGTCTAATATCAT
TGAAATTCCTTATGGCAATTGTTCACGGTCGCATATGTGGATCGTATTTCCAGACGCTAT
ATCTAACGACCAATTGAATCAACTAGAAAACATGATGCATGGCGATACGCTAAAGGCATT
TAAATACGCATCGAGAAAAAAGTATCTAGAGCTCTCCATTCCTAAGTTTAGAATAGAACA
TTCTTTTAACGCGGAACATTTACTGCCTTCTGCAGGGATTAAAACATTGTTCACAAATCC
CAATCTTTCGCGTATGATTACACAAGGGGATAAAGAGGATGATCTATATCCTCTTCCCCC
ATCCGTATATCAAAAAATTATTCTTGAGATAGATGAAGAAGGAACAAATACAAAAAATAT
AACAAAGAAAATGAGATATAATACTCAAGAAGATACATACCAACATCTCTTTCGCATTGA
ATCCATATACGTGAACCGTCCCTTCATCTTTATAATAGAATATGAAAATGAAATTCTCTT
TATAGGTAGAATATCCATTCCCCAATAATTATTATATTTCATGTCTAATAAATTATGGCG
GAGAAACCTGAGTTTTCTATTTTTTTTTAGTTTGGTGGATTTCCTCCCTCGTTCACAAAA
TTATTTTTGGGATATGGAAGTGTGTGAGAGGGACGATAGTATTAATTCTTAAGGTTATAG
GATTCATCGCATATGCATTGAAAGGATTTTGTCAATTATTGATAAATAGCTTTGCAAAAA
TCTGCATGCTATGCATATTTTATTTATCTAGATTATGCAATCTAATTATATACAGTCTGT
ATTCTCTATCGATGTATCCTATGAAAAAATTAATTTCTTTTATGTTTGGAGAACTAAATC
CGTTTCATGATGTACTTCCGGATCCACATAAAAAAGATGACGATGCGGAAATCTTTCCCG
ATGATGAAAAAATATATTTACCCATCATGCCTCCGGAACCGAATCCCACCCCCAATATAA
AACCCAAACTTAAGGAACAAGCGGAAAAACCCCCAATATCGGAATCCAACAATGGCGCTG
GCGTTGTGGAAAAGGCTATAAAGCCCGAAGAGGATAGATTTAATGGCGTATTTGATTTTA
TGAAAATGCCTAATCCATTCAAACGATACTACGAATATTGTTACCCTTATCCCTATAAAA
AAGCAAAAACTCAACCGAAAAAGGTTGAAGAAAAAATTGAGAAAAGTTTTTTAGAGAAGA
TGGTTGAAATGGTTGAATAAATAATATAAGATGAAAAATAAATTCGAGACATATACGTTT
ATAACAGCCTTCCGCTGTTATATTTCTTTTACAATAAACAAATATGGAACATCAATACCA
TATTGTTAACTATGCATATTGTGATGAATTTACTGAATCCGACGATATAACGGTGGCCAT
TGCCGATTATTTATATTGGTCATCCAAAGAATTTCGTAGTAGAGATAGAGCCGGAAATGT
GTTCGTTGCTCTTGAATCATTTAAACAGGAAGCTATAGAAGTATTTGGTAAAGATTTGAC
AACATTTGTAAAATTATTATTCTTGGATTCAAAAGAGGGATTTAATCATGCAAAATCTTT
TATTGGTCTTTCCTTGGAAAGGGAAAACCTTACACAAGAAGCCTGTGCAATCGTCGGTCT
ATTAGCAAAAGCCGCAGAATATTGGGGTGGTGAATCTATTCCCACACGCGCCTCTGCTAA
GGTTCTAATGTTATTGGGTGAATTATTAACATTCGAAGATTTGACATCTGTAAAGGCAAT
ATTGATTAATAGAATGCTCAAAATATAAATTTTATAAAGTTGTTATACTAAATGTTTTTA
TTTGATGTATAAATTATCTTTCCCATACCTTCATAAAGGAATAAAACATTTTATCCCTTT
CCCATACCTGAATAAAGGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAAT
AAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAGGAATAAAAC
ATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAGGAATAAAACATTTTATCCCTTT
CCCATACCTGAATAAAGGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAAT
AAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAGGAATAAAAC
ATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAGGAATAAAACATTTTATCCCTTT
CCCATACCTGAATAAAGGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAAT
AAAGGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAGG
AATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAGGAATAAAACATTTT
ATCCCTTTCCCATACCTGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAAT
AAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAACATTTTATC
CCTTTCCCATACCTGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAA
GGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAACATT
TTATCCCTTTCCCATACCTGAATAAAGGAATAAAGGAATAAAACATTTTATCCCTTTCCC
ATACCTGAATAAAGGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAA
GGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAGGAAT
AAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAGGAATAAAACATTTTATC
CCTTTCCCATACCTGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAA
GGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAACATTTTATCCCT
TTCCCATACCTGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGA
ATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAACATTTTATCCCTTTC
CCATACCTGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATA
AAACATTTTATCCCTTTCCCATACCTTCATAAAGGAATAAAACATTTTATCCCTTTCCCA
TACCTGAATAAAGGAATAAAGGAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAG
GAATAAAACATTTTATCCCTTTCCCATACCTGAATAAAGGAATAAAGGAATAAAACATTT
TATCCCTTTCCCATACCTTCATAAAGGAATAAACCCATCATTCGGGTAGTTTTATTCTAT
TGTTTTTATCTTTTTTTTAGGTATATAAATTATAAAATTAATAAAAAATAATAGATGTT