>NC_003059|Porcine endogenous retrovirus, complete genome.
TGAAATGGAGTTTTAACTAAAGAACAACCCCCCCCCCCCTTGGCTAAGAAGGCAGCTGCA
AGCCTTTCCAACTGTGCTAATCACTATGCCACCCTTCTTGTAATAACATAACAACTGTGT
GCTCTCTGTCCAAGCCAGCAGCCCTGCTAATTAGGTACCCAGCATTGCTTATCAGTTCTG
CTTCTGTAACCTTGCTTGCTCAATTTCTTAGGGAGGAACACTGTCTGCTTGGGGATGGGG
GAGGTCCAGGATGCTTACATGGGAAAATCAAGACCTTGTAGTGTATAAAAGTTACTGAGA
ACAAAGACCTGGTGCTCAGACTCTGGAGGTGACTCCTCTGAGCCCACACCAGTGCTGAAT
AAACCTTGCTTTTCCATATCTCTGAGTGCTGTTTGTCTCCTTCTGTTGCCACAGTTTTTG
TGGTTTCTGCAACATTTTGGTGCATTGGCTGGGAAGCCGACAACCGAGCTGGCCTCTTGT
GCCACCGTTGTCTGGGAACTGGGGGAGGCCACGGTCACCGGCCTGGTGACAGGTGGATAG
CACACACCGGCCATTTTGCCGGATCCAGACCCTCACTTGGGCCATGGCCTTGGCCACACC
GCTTCCCGAATGGACTCAGAAGGAGAGTGGAAACAGGTTCCTGGACAGGACGTCAGACTG
GTGAGTGCCCCGGGGACATCTGCCCAAGTCAGGACCCACCATATGGTGAAGGAGAGACTG
ATCACCTCTCAGTGACCAAAGGGTCACTCAGGTCAGGGTTTGCTCCGTTGGCATCGGGAG
GCTTGTCAATTCTGGTGTGTGTGTGTGAGTGACTGGAGAGAACAAGAGCCCATGCTCCAC
CATCTTTGGACTACGGAGTCAGAGTGAGTCCTAACCTGCAGTTCCATGGCGACCCTCATG
CGGCTTATGGTGGCCCTCTTCAGGGGGATCCTGATGTTGGGGTTTATACAGTCCCACCTA
TGCTAAGAGGCGCCTGAAATATCTCCTCCAGGGGAGAGGTCAGACGGACGAAGAGATTGT
TCGTCTTGCGTCACCGGCACAGGGTGGGACTTCACACAATGGGTAAATCGGCTTCCAAGC
CCACTGTCTTAGAGCATATGGTTAAGAATTTTAAGAAAGGATTTTCTAGAGATTATGGTG
TTAAACTGAGTCCTGGAAAACTGTGTACCCTCTGTACCCTAGAGTGACCCTCATTTGGTG
ATGGTTGGCCTCCAGAAGGGACCTTAGATGTGTTCACAGTTGCAGCAGTATATAATGTTA
TAACAGGAGACCCTGGACACCCAGACCCATTTCCATATATTGATCAATGGTTGGAAATTA
CCTATTTGAGGCCCCCATAGGTTCGGTTCTGCACTACAGACCAGGGACAGTGTAAGGTGC
TAGTAGCCCAGTCCAAGAAGAAAATCTTGTCCCAAAAAAGGTGCCACCTATTTATCAAGG
GGAACCTGAGGACTCGCCCCCTATGCCACCATCTTATGTGCTGCCGGCCCCACCTCCAGG
AGCCAAAGGTCCCCAGATGCCAGATAGCCCACCACCTTCTGTTTCTCCTCCACCTTCTGC
TTCTGAAGTTCCCGAGGCAATATCACCCCTGCAGCCAGTTTCTCCAGAACCTATGAGCAG
GCGTCTCCATTCAGCTCAGGCAGCAGCCACTCCAGCATTACAAATGCCCTTACGGGAGAC
ACGGGGACCACAGCAAGTCACCCCCAATGGGACCATACAAGAGGGGGGATGTTTTTTATT
ATTACCAGCCCTTTTCCACCGCTGATCTCCTCAACTGGAAACACCGCACTCCCTCATATT
CTGAAAAGCTTCAGGCACTGATTGATCTCTTAGAATTCATTTTCCAGACACACTGTCCCA
CCTTGATAGACTGACAGCAACTTCTTTTTACTCTATTTGACACTGAAGAGTGCTGGCGAA
TTGTAACAGAAGCCCAAAAATGGTTTCAGGCCAATGCAGGGGGTCAAGCAGACTTGGCAA
ACTGGGTGAGGGAAACCTTCCCAGAAGAAAACCCCCACTGGGACTATGACACTGAAGAAG
GGAAACGTAACCTTGAGAGGTACTGGTAGGCCTTCCTACAGGGGGCAAAAGCTGGGGCTA
AAAAGCCCACTAATATAGCTAAGATCAGTGAGATACTACAAGAGCCGAATGAAAGCCCAG
CCAAATTCTATGAGAGACTATGTGAGGCTTTCCGAACCTACACTCCTTTTGATCCCGAGG
CCCCTGAGAACCAAAGGGTGATAAATCAGATATCCATAAAAAGCTACAGAAATTAGAAGG
CTTTGCAGGAGAGAATGCCACTAAACTGTTGGAAATAGCCAACAAAGTTTTTATTAACCG
AGACCAGGTGGCCCACTGTGATGCAGAAAAGAGAATGAAACAAAAAGTGACTCTTCTGGC
AGCCTCCCTGTCAAAACTTGTGCCCCCAGTGGGACCACCCCATAGGGGACAAGGCACAAG
GCCAGGGAAAAGGAGTCCCCTGGAACATGACCAATGTGCTTACTGCAAAGAAAAGGGACA
TTGGAAAAATGAATGCCCCAACCGTCCTGAGAAAAAGACCAAAGCCCCACCTAGCCGGTA
CCGATCTGAGCCACTCAGCACCAACCTGATCGGCCTAGCGGAGTCTGACTGGGGGGACCA
GGCTCTCTCCAACTGGGCCGCTGAGAGCCTATGGTCAGAATTCAAGTAGGGGGCCACCCC
ATAGACTTTATGGTTGACACAGGTGCCGAACTTTCTGTGGTTACACAACCTGTGGCTCCC
CTCTCGGGGAAAGAAACCACCATTGTTGGGGCCACAGGTAACCAAACCCACAGGCCCTTC
TGCGGTCCTCGACGATGTCGGTTAGGAGGCCATGAAGTAATACATGAATTTCTTTACCTA
ACTGACTGCCCAGTTCCCCTGATGGGAAAAGACCTGCTGGCTAAAATGGGGACACAAATT
TCCTTTTCTACTGATGGATCAGCCCAACTCAAATTGACAGAACCGCCCTCTCCTTTAATC
ATGGCTCTTGCTGTAAAAAGAGAAGAGGAATGGTGCTTGTACTCTTCCCCTTCAGAAATG
GGGACCATTCCCCCAGAACTAGAGACTAAATACCCATTGGTTTGGGCTGAAGGAAACCCA
CCAGGACTGGCAAAATGCCACGCTCCTGTCTTAATTGATCTAAAACCCAGAGCTCAACTG
GTAAAGCTATGGCAATACTCAATGCCCAGAGAAGCTTGACTGGGAATCCAGGTTCACCTG
GATAGGCTGCTTCAGCACGGACTGTTAATAAAATGTCAGTACCCTTGGAACACCCCTTTA
CTGCCAATGAAAAAACCGGGAACACAGGACTACCGCCCAGTACAGGACTTGAGAGCCATA
AATGAAGCAACAGTCACATTACACCCATCCGTCCCTAACCCATATACACTGCTAGGGCTG
ATCCCCTCCACTGCTGAGTGGTTTACTTGTCTGGACTTAAAAGATGCTTTTTTCTGCCTC
CGGATGCCACCTGCCAGTCAGCCCTTGTTTGCTTTTGAATGGCAGAATACACATACAGGG
ACAAAGGAACAGCTCACCTGGACTAGACTCCCACAAGGATTCAAAAACTCTCCCACTCTT
TTTAGCAGCGCCTTAGCTGCTGACCTGGCTGAATTTCCTGGACAAAAACTGGGCTGTGTT
TTGCTACATTATGTTGACGACCTCTTACTAGCTGGCACCATGGAGGCTCAGTGCCTAGAG
GGAACAAGAGCTCTCTTTTCCCTACTGATGGAAGCAGGGTATTGGGTATCAAAGAAAAAG
GCACAAATATGTAAAAAACAAGTCAAGTATCTGGGCTTCAACATCATGCAGGGCCAATGA
ATGCTGGGGACTGAAAGAAAGCAGGCAGTTTGTGCCATTCCTGTCCCTACCATCTGCCGG
AATGTTCGTGAGTTCCTAGGGGCAGCAGAATTCTGCTGGATATGGATCCCCAGGTTTTCA
GACCTGGCTAGGCCTCTGTATGAGGCTCTAAAAGGAGAAGAAAAGGCTCCCCTTAAATGG
GGACCAAGCCAGGAGACAGCGTTTCAGACAATCAAAACTAAACTCACTGAGGCTCCAGCC
TTGGGACTTCCTGATGTAACCAGAGAATTTAACCTTTTTGTTCATGAGAAAAATGGGGTG
GCTTTGGGAGTCTTAACAAGAATTTGGGCCTTGGCAGAGGCCAGTGGCATATCTGTCTAA
ACAAATTGACTCAGTTGCTGCCGGATGGCCTCCCTGCCTCTGAGAGCTGGCAGCTACCAC
CTTGTTGGTGAGAGAGGTTGACAAGTTGACCCTGGGACAAAACCTCAATGTTAAAGTCCC
ACACTCAGTTGTAACCCTAATGGATACCAGGGGCCACCATTGGCTCACACATGCACGAAT
GACTCAATATCAAGGGTTACTATGTGAAAATCCATGGGTAAAATTGGAGGTTGTATGAAC
TCTGAACCCAGCTACTTTTCTGCCAGATGAAGCGGGGCCCCCAGACCATAACTGCCTGGA
GGTACTAGATGAGGTGTTTTCCAGCAGGCCTGACTTGACTGATAAACCACTCCAAAATCC
TGACCTGGTTTTATATATTGATGGCAGCAGCTTTATGGAGGATGGAAAAAGGATGGCAGG
ATATGCTGTGGTATCTGACTTAAAAGTGATAGAAGCAGAGGTGCTTCCTCAAGGCTGGTC
AGCACAGAGAGCAGAATTATGGGCCTTAATCAGAGCACTGGAGCTCAGCCAAGACCAGCA
AGTTAATATCTATACCGACTCATGATATGCCTTTGCAACTTTACATGTCCATGGAGCCTT
ATATAAAGAAAGAGGGCTCCTCACTGCTGAAGGAAAAGGAATTAAAAACCAGGCTGAAAT
CTTAAAGCTCCTAGAGGCAGTATGGGAACCTAAAGAAGTTGCAGTTATCCACTGTAAAGG
CCACCAAAAGGGGGATGACCCAGTAACAAAAGGAAACCATAGTGCTGATGCAGCTTCCAG
ACAGGCAGCCCGGGGACAACAGCCAGACAAACCTAAGGTCTTGCTGGCCCCAGAAATGCC
AGCTGTCCCCAAATATTCTCCAGAGGAAGAAAAATGGATAAGGGAGGAAGGAGGAACTAA
AACTAAAACGGGATGGTGGGTCACACGGGACCACCGAGTTTACATTCCAGAACAGCTGGC
CCACAAACTAGTCTGCCAAGAACATGAGCTAACCCACATGGACAAAACTGCCTTAGAGAC
CCTACTGGGCTGGTACTATCTCATTGCTCATCTTCCTGCACTCTGCTCCTCTGTCTCCCA
AAGGTGCATAACCTGTTTACAGAATAATGCCTGCCAGGGGCCCCACAGACCAGCTGGGGC
ACAGCACTGCAGACTGTCCCCATTTGAGGATATGGAAGTGGACTTCACTGAGGTCACCCC
TAGTAAAGAGTACAAATATTTACTAATTTTTATCTGTACTTTTTCAGGATGGGTAGAGGC
CATCCCTACCTGAACTGAAAAGGCAAGGAAAGTAATCAAGGCACTCCTGAGAAACATTAT
TCCCAGATACGGAATGCCTCTGACCATCAGGTCAGATAATGGACTGGCATTCATGGCTGA
AACAGTACAACAGGTGGCAAAAGCTTTACAGATCCGATGGAAACTACATTCTGCTTATTG
CCCTCAAAGTTCAGGGAAAGTAGAATGCATGAACCGAACCCTTAAACAGACCCTGGCAGA
GTTATGTCAGGAAACTGGCTTGCCCTGGATAGACATGTTGCTGGTGGCCCTCTTAAAAGT
GAGATGCTCACCCCGAGCGGGAATAGGATTCTTGCCATTTGAAATCTTATATGAAAGGCA
ACCTCCACTAATCAGTTTAAAAGGAAACACCAGGGAGTTGAGAGACTTGGAATTACATAA
ACAATTACAAGGACTGGGGCTCACTATTTCTTGGATATATAAATGGGTCACAGACAGAAT
ACCTGTGTCCTTAGGTATAACAGTACACCCCCACAAGCTGGGGGACCAGGTGTGGATAAA
GGACTGGAAAAATGAGCCCTTGAGGCCAGTATGGAAGGGCCCCTATACTGTAATTCTAAC
CACCCCCACCACTCTTAAAGTAACAGGAATAGATGCTTGGATCCATCATTCCAGAGTTAA
ACCAGCTGGCCCAGCTGACAACCGTGGAGAGTGGGAGACTGCCCTCGATCCAGAGACCTC
TTTGCCTGACAATACAGAGAAGGAGACGATGATCTCAAAGCCCTGCTCTGACCACATAAG
CATTCGCATTGATGGAAGAGGCCTTGACCCTGGAACTGTGCTACATTTCCAGAGAATCAC
ATTTGCACTCCAAGCTGCCTCTCACAGGGTCTTTCATTCCTTTTATAAAGAGATAAGAAA
CACCCCACCTCCCGTTCCGGCCACAACTAAGAATTTGTTCTTAGCCCTGGCAGAAAATAT
TACACAAACTTTCAAGGTCTCCTCTTGTTATGTATGTGGGGGAACAAACACAGGAGACCA
CTGGCCTTGGCAAGCCAGAGAGCTGGACCCATTAGAGCCTCATAATGAGACTACATACCC
CCAACTCACCAATGGGGTATGGCTCCTCAGAACTGCTATTATAGGGAGAAATTGTCTTGC
GAGGTGGGGAGGACAGTTTAATGTTTGAGTTGGAAGCCTAACATGTTTAGGCCTAAGGTA
TTATAATCTGACTGCCCAAAAGACTCAATGGTGGTCATCCTCCAATCGCTCAAAGCCCAA
GCCTAATCCCTTGTCTAACTTTTCCCTCCTTCGACAAGCATGGGAAGATATCAGTACTAA
TATCCATTGGCGGGCACCAAAGGGATTATATTGGATTTGTGGAAAAAAATGGCCTATTCC
ATACTCCCCTCCAAATTGGACTGGGGTATGTGTACTGGGAACAATCAGATCTTCCTTCTT
CCTGCTCCTGCTGTCACTAGGGGAGCAACTGGGAGTTCCTATATACAGCACAGGGTGCCC
AGAGAGACCGGAGGGCTGTCCAAATTGGAGACTGGAAAGTTGATGAATGGCCCCCAGAAC
AGATAATTCAATATTATGGACCTGCCACCTGGGCAGAGGATGGCTCTTGGAGATATCACA
CCCCTATCTATATGCTGAACCGCATCATCAGACTACAGGCAGTTTTGGAACTTATAACAA
ATGACACTGAAAGGGCCTTGACTATATTGGCCCAACAACAAACTAAAATGCTCAGTGCAA
TCTACCAAAATCGCTTGGCCTTGGATTATTTACTTGCTTCTGAAGGAGGGCTTTGTGGAA
AATTTAACTTAAGTAATTGCTGTCTACAAATAGATGACACCAGAAAGGTGGTAGAAGAAA
TTGCTGACCGCATGACTAAACTAGCCCATGTACCTGTACAAACTTGGAAAGGATGGGATG
CAGACAGTCTCTTTGGTAAATGGTTCTCTTGGTTGGGAGAAATTAAGACAATGGTTGGAA
TAGTCATGGTTATACTCGCAGGGTGCCTACTTGTTCCCTGCCTTGTACCTCTCCTGATAA
ATATTATAAAAGGTTTTATAAAAACCATGGTTGAAAGAAAAACAGCCTCCCACCTGCTAC
TTATTAGAGGCTACCAAAGGGTTATGACTGATGATGATCTGTAAAGGGTGCAGATGCACC
CTGAACATCAAGAGGGGGGAATGAAATGAAGTTTTAACTAAAGAACAACCCCCCCCCTTG
GCTAAGAAGGCAGCTGCAAGCCTTTCCAACTGTGCTAATCACTATGCCACCCTTCTTGTA
ATAACATAACAACTGTGTGCTCTCTGTCCAAGCCAGCAGCCCTGCTAATTAGGTACCCAG
CATTGCTTATCAGTTCTGCTTCTGTAACCTTGCTTGCTCAATTTCTTAGGGAGGAACACT
GTCTGCTTGGGGATGGGGGAGGTCCAGGATGCTTACATGGGAAAATCAAGACCTTGTAGT
GTATAAAAGTTACTGAGAACAAAGACCTGGTGCTCAGACTCTGGAGGTGACTCCTCTGAG
CCCACACCAGTGCTGAATAAACCTTGCTTTTCCATATCTCTGAGTGCTGTTTGTCTCCTT
CTGTTGCCACAGTTTTTGTGGTTTCTGCAACA