>NC_001625|Southern cowpea mosaic virus, complete genome.
CACAAAATATAAGAAGGAAAAGTGCTGATTTTCCTACCTTTGTGTTTCATGATTTATGAG
ACATTGGTTTTAAGCAAAACTGAGTTAGAGCAACTCAACGTCGATTTACCTCGATATTCC
TACAGGTTTCGTTACAGTCGTTCGATTGGCGATACTGTAGTAGAGTTTCCTGGTACTCTC
TCGGACCCCTGTATCCCTGTCGTTGACGTACTCCTTGGAGCTTGTTGGGCTTGGCCTCAA
CCTTCACGACACGGTGGTTTGGGGTTAGATGATATCGACCCTTTTGACGCTAGCTTCTCG
TGCTGCGTGACCTCTCCGGAAAGGTACTGCCTATCAAGGTCTGTATTAAGCGGAGTTGAC
GCGTTTGTTGTCCGCGGATCCTGCAAGTTGTGTGGATTAGGATTTCTCGACAATTTCAAT
CCTTTTGAAATTCGTGCGTTGCTTGGTCAAACCACTCCTGGTTTGTGGTGGCAACCCGTC
AAGCCAGTCTACGACGACAGGAACATTCACCTCCCGTACGACTCCGAGCTTAACGCGAGA
ATACAACGCTTCCAGTACACCTGCCGAGAATGTATCGTCCGAGTTGCCTTTCATATGTCC
TCCTAGTTGCGAACATGTGGAGCTTCGCCGTGTGCGCAAATGCGTTCATCTACGGGTCAT
ACGACCCCAGCCACAATATTCCAATTGTGGCCTTGATGACCCTGTGCGCTACAGGGCTCT
GGTTGAGCACGTCCGTGGTGTCCTTCGGGATTCGCTACGTGAGGGTGCGAGTTTCGCCTG
AAAAGACGCAGAACCGCACCATATACGTCTCCTCTGGGCTACCTCATTTTGACCCCGTTT
ATGGGGTTGTTAAGAAGTGTGAGCCTATGGGGGGCGGCCCAGCCATTGAGCTACAGGTTA
ACCCATCTTGGATCCATCTCCTGCCTACTTCTCCTGCGATAAATAAGGTTGAAGTAGGAC
AGGAATCGGCCATTTTGGGCAGTACCTACTCTGTAGTGGAAACCGGTGGAGAGCCTAAGA
GTTTGGTTGCCGTTAAGAGTGGAGACAGCACCCTTGGGTTTGGAGCCCGTGTCTACCATG
AGGGCATGGATGTCCTCATGGTACCTCACCATGTGTGGTACAATGACAAACCCCATACAG
CTTTAGCCAAGAACGGTCGTTCGGTAGACACTGAAGACTGGGAGGTTGAGGCTGCATGTG
CTGATCCACGTATTGACTTCGTGCTAGTTAAAGTCCCCACTGCGGTGTGGGCTAAGCTGG
CTGTTAGGTCTACTAAGGTGTTGGCACCAGTGCATGGAACTGCAGTCCAAACATTTGGAG
GGCAGGATTCCAAGCAATTATTCTCGGGCTTGGGAAAGGCGAAAGCCTTAGACAATGCCT
GGGAATTTACTCACACAGCTCCAACCGCTAAAGGATGGAGCGGGACTCCGCTCTATACTA
GAGATGGAATTGTGGGTATGCACACTGGTTACGTCGACATCGGCACATCAAACCGGGCCA
TCAACATGCACTTCATTATGTCCTGTTTGGTGTCCAAAATGGAGACTCTCCCCCCAGAGC
TTGGCTACCGCGAGATATCCCTAGAGGATGTCGGACTCCGTAGTTTTGAGTTTCTAGAGG
TGGAGATTGAGAATAGGGGCAAAGTGAAGTTGGGTAAGCGTGAATTCGCCTGGGTGCCTA
AAGGGAAAGCCTGGGCGGACATGCTTGACGATGATGATTTACCCCTTCCTCCAAAGATGG
TGAATGGGAATCTGGTTTGGGCTGATGCTCAAGAGAGCTTTGATGGAGCCCTTCCTTTAA
ACTGCTTGCGGGCGGCCGGACGCAATGTCTTGCCGCCCAAATTGAACTTGGTGACTATAA
ATTCTCCTGTGGACCCACCCACGAAACAGGTGGCATGCCCTTCAGAAATTGTGGATCATC
GACTTGCAAGTTTAGAGAAGTGTCTCGAAAACCTGTTGCAGACGCTGTCACAGCCGCAAC
AAAAGTTTTCCCAGAACTCTCTGAGCTCGGGTGGCCTGAAAGGGGATCAGGAGCTGAAAT
TGGCTCCCTGCTACTCCAAGCAGGAAAGTTTGTTCCCACCAAAGCCCCGAGCAACCTCGA
GCAAGCCTATAACAACCTCCTCTCCAGGTACCCCAGGTCGAAGCCCCTTGCCTGTTTCAG
GCAAGGAACTTGGTCCTTCGACGCAATCTTCGAGCAAGTTGTCTCGAAAGCAACGTCGGC
GGAGATCAACCGAAAAGGCCAGTCCAGGGGTCCCCCTCTCCCGCCTCGCCACCACCAACA
AGGACTTAATGGCGCAACACATGCAGTTCGTAGCTGCTTGTGTAACTGGGAGAGTGCCAC
TCCTAGCCTCCTTCGAGGATATACACGCTCTATCTCCCACTGAGATGGTAGAGATGGGCT
TGTGTGACCCGGTGCGGCTTTTTGTCAAACAAGAGCCGCACCCGTCTCGTAAGTTGAAGG
AAGGGAGGTATCGGCTTATCTCCTCGGTCTCAATCGTCGACCAATTGGTCGAAAGAATGC
TCTTTGGAGCTCAGAACGAGTTAGAGATTGCTGAGTGGCAATCTATCCCTTCAAAACCCG
GTATGGGGCTTTCCGTCATCCACCAAGCTGACGCGATATTCCGTGACTTGCGAGTCAAAC
ATACCGTGTGTCCTGCAGCTGAAGCAGACATATCTGGTTTTGATTGGTCCGTTCAGGACT
GGGAATTGTGGGCTGATGTTGAAATGAGAATCGTTTTGGGCTCTTTCCCACCCATGATGG
CTAGAGCTGCTAGGAACAGGTTTTCATGCTTCATGAACTCAGTCCTGCAACTCTCAAACG
GACAGTTACTCCAGCAAGAGCTGCCGGGGATCATGAAATCTGGATCTTATTGCACCTCCT
CCACTAATTCGCGGATACGTTGCCTTATGGCTGAGCTTATTGGTTCCCCATGGTGCATCG
CCATGGGTGACGACTCCGTGGAGGGTTTTGTGGAGGGGGCTAGGGAGAAGTATGCGGGGC
TGGGGCACTTGTGCAAGGATTACAAGCCTTGTGCAACCACCCCCACAGGCCAGTTGTATG
CCGTGGAGTTCTGTTCCCACGTGATTAAACGCAATAAGGCGTTTCTTACATCATGGCCCA
AAACTCTGTATAGGTTCCTTAGCACGCCGAGGGAGACGCTGGAAGATCTCGAGAGAGAGC
TTGCATCCTCCCCCATGTGGCATAAGATTCAGAGTTATGTCCGGTCTATTCCATCACCGG
ACAAAACCGCGCGAGATAAGAGCATTTGTAATGGCTACCCGCTTGACCAAGAAGCAATTA
GCACAAGCTATTCAGAATACTCTTCCAAATCCGCCTCGGCGGAAGCGACGCGCGAAGCGG
CGTGCTGCGCAGGTGCCCAAGCCTACCCAAGCTGGGGTATCCATGGCCCCTATTGCTCAG
GGGACCATGGTGAAGCTTAGGCCTCCCATGCTACGCTCGTCGATGGACGTGACCATCTTG
TCTCACTGTGAGCTCTCCACTGAGCTCGCTGTCACTGACACGATAGTTGTTACGTCCGAG
CTAGTCATGCCGTTCACTGTGGGAACTTGGCTTCGTGGTGTAGCACAGAACTGGTCGAAG
TATGCTTGGGTTGCGATTAGGTACACGTACCTACCGTCTTGTCCCACTACTACGTCCGGC
GCCATTCATATGGGGTTCCAGTACGATATGGCTGACACCCTTCCCGTGAGTGTCAATCAG
CTGAGTAACTTGAAAGGGTATGTTACTGGTCCTGTGTGGGAGGGTCAGTCTGGCCTTTGT
TTTGTTAACAATACAAAGTGCCCGGACACCTCCCGAGCTATTACCATAGCCTTGGATACT
AACGAAGTCTCTGAAAAGAGGTACCCCTTCAAGACCGCGACTGACTATGCCACCGCTGTC
GGAGTGAATGCCAACATTGGCAACATTCTTGTGCCCGCTAGGTTGGTGATAGCGATGGAA
GGAGGATCATCTAAGACTGCTGTGAACACTGGGAGGCTTTACGCCTCATACACCATACGG
CTGATTGAGCCCATAGCGGCGGCATTAAACTTGTAGCGAAGTATAAAACGCTTTACCCCT
GGTGGTTGGCGCCTAGGGGCGGACTCTGCACAATAGACTATGGTTTGGAAATCTTGGACC
ATCTAGTTATGTTTAGGAACGATTTCCCGCTGGAACCGAGCGCTATCCGAATGG