>NC_001514|Woolly monkey sarcoma virus, complete genome.
TGTTGGGAACCCAGGCTAAGCTGATGCTATTGGAACAAAAGGTTGCATCAGCCCTCCCCG
CCAAAAGCATGCCCCGGGCGTGGTGGCGGGCCACCAATGGAGGACCTGATCACGGGCAAG
ACATGCCTCAGGGCCACCAATGGAGGACCTGATCACGGGCAAGACATGCCTCAGGGCCAC
CAATAAAGGACCTGATCACGCACAGAACATGCATGGCTGCACCAATGGGGTAGCTGATCA
TGAGCTAAACACTCGTCTCCCAGCCTATCAGAACTACTTCCCCTTTCCCCTCTCTACCCG
CTCCCCTCCCTATATAAGGAACCCATTTTGAAATAAACTTTGCAGCTTGATCAGAACTTT
TGTCTTGCTGCCATTCTTCGCGCCTCTTGTCCCATCCCTTTCTCATCCACGACAGGCTTG
CTCGGGTTCCTGTTTGTTGCTCTGCGGGACAGAGCAAGTGGCGCCCAGGACGTGGGGCTC
GATGCCGGCCTCCGTGGACCGCCGTCCCCTGTAACCGGTTCCCTGCACGGCCGTCCCGAT
TAACCGATTCCCCGCACGGAGCACCGCGGACCACCCGACCGCGAGCCGACTCCTGGAGTT
CGTTCCTCATTTCGACGGCGGCATTACTCAAGTAAGACCCAATCATGGGACAAGCATCTT
CACACAGTGAAAATGATCTCTTTATAAGTCACTTAAAGGAATCTCTCAAGGTGCGTAGAA
TTCGGGTTCGCAAGAAAGACCTTGTCTCCTTTTTTAGTTTCATTTTTAAAACATGTCCAT
GGTTCCCCCAGGAAGGGTCTATTGACTCCCGTGTTTGGGGACGTGTTGGTGATTGTCTGA
ACGACTATTACCGTGTTTTTGGTCCTGAGACTATTCCGATCACCACTTTTAATTATTATA
ATTTAATAAGGGACGTCCTTACTAATCAGAGCGACTCCCCTGACATTCAACGCCTCTGCA
AGGAGGGTCACAAAATTCTTATTAGCCACTCCCGACCTCCATCTAGACAAGCCCCTGTAA
CAATTACCACCTCTGAAAAGGCCTCCTCTCGCCCTCCCTCTAGGGCCCCTTCTACCTGCC
CCTCGGTTGCAATTGACATTGGTTCACATGATACAGGGCAGTCTTCACTGTACCCCAACC
TTGCAACCCTTACGGACCCCCCCATTCAAAGTCCTCATTCTCGGGCGCATACTCCGCCCC
AACATTTGCCCTTGCTTGCTAATTCTAAAACCTTGCATAACTCGGGTAGTCAGGATGATC
AACTAAATCCCGCCGATCAAGCAGATCTGGAAGAGGCAGCTGCCCAATATAACAACCCTG
ATTGGCCCCAATTAACTAACACCCCGGCATTGCCACCTTTCCGGCCACCGTCCTATGTTT
CTACAGCAGTGCCCCCAGTGGCAGTTGCGGCTCCTGTTTTGCATGCCCCTACTTCAGGCG
TTCCTGGTTCCCCCACGGCCCCAAACTTGCCCGGTGTAGCCCTAGCCAAACCCTCCGGTC
CCATTGATGAGACTGTTTCTCTTCTTGATGGGGTTAAAACCTTAGTCACAAAACTGTCCG
ATTTGGCCCTTCTACCTCCCGCGGGAGTTATGGCTTTTCCCGTTACCAGAAGTCAGGGAC
AGGTTAGCTCCAATACCACGGGCCGAGCGTCTCCTCACCCTGACACACACACCATCCCTG
AGGAGGAGGAAGCAGACTCCGGAGAATCTGACTCAGAGGATGACGAGGAGGAAAGCTCAG
AGCCCACCGAGCCTACCTACACCCATTCCTATAAGCGGCTAAATCTAAAGACCATAGAAA
AAATTAAAACTGCTGTTGCTAACTATGGTCCTACTGCCCCCTTTACCGTGGCCCTTGTAG
AGAGTCTTAGTGAAAGATGGCTTACCCCTAGTGATTGGTTTTTCTTGTCTCGTGCTGCGC
TGAGCGGAGGGGACAATATCCTTTGGAAGTCTGAGTATGAGGATATTTCCAAACAGTTTG
CAGAGCGAACGCGCGTAAGGCCTCCTCCAAAGGATGGACCCTTAAAAATTCCTGGCGCCA
GCCCTTATCAGAACAATGACAAACAGGCCCAATTCCCCCCAGGGCTTTTAACCCAGATTC
AGTCCGCAGGCCTAAAAGCCTGGAAGCGACTCCCTCAAAAGGGAGCGGCTACTACTTCCC
TTGCAAAGATTAGACAAGGCCCCGATGAGTCATACAGTGATTTTGTAAGCCGCCTCCAGG
AGACGGCAGATCGCCTTTTTGGCTCCGGGGAAAGTGAGAGCTCCTTTGTAAAACACCTAG
CCTATGAAAACGCTAACCCCGCTTGCCAAAGTGCAATTCGGCCTTTTAGGCAGAAGGAGC
TTTCGACTATGTCGCCTCTGCTCTGGTATTGCTCTGCCCATGCTGTTGGCCTAGCCATAG
GAGCTGCCCTCCAAAATCTTGCCCCCGCGCAACTCCTGGAGCCCAGGCCCGCCTTTGCTA
TAATTGTCACCAACCCGGCCATCTTTCAAGAAACTGCCCCCAAAAAAATACAACCACCTA
CTCAACTCCCAACTCAACCTAATGCCCCACAGGCTAGCCTTATAAAAAATTTAGGTCCCA
CAACAAAATGTCCTCGCTGCAAAAAAGGATTTCACTGGGCTTCAGAATGCCGTTCTCGAT
TAGACATTAATGGACAACCCATTATTAAGCAGGGAAACTTGAACAGGGGCCAGCCCCAGG
GCCCCACTACCGGGATGAACTCCGGGGCTTCACAGTTCACCCCCCAATACCGCCAGCCAA
CCCCTGCCCTCCCAGTAATCAACCACGCCGCTACGTCACAGACCTCTGGCGAGCAACAGC
GGGCAGTGCAGGACTGGACCTCTGTACCACCACCGACACAATACTAACCACCCAAAATAG
CCCTCTGACACTTCCAGTTGGAATATATGGACCCTTACCACCCCAGACATTCGGCCTCAT
ATTAGCAGAGCCAGCTCTACCCTCCAAGGGGATCCAAGTTCTGCCCGGCATATTAGACAA
TGATTTTGAGGGAGAAATCCATATCATTCTCTCTACAACTAAAGATTTAGTCACCATCCC
AAAGGGCACCAGACTAGCTCAAATAGTCATTCTCCCCCTCCAACAAATTAACTCCAATTT
CCATAAGCCCTACCGCGGGGCTAGTGCCCCTGGGTCTTCTGATGTCTACTGGGTTCAACA
AATTTCTCAACAGCGGCCTACCCTGAAACTTAAATTAAATGGTAAGCTCTTTTCTGGCAT
TCTTGATACAGGGGCCGATGCCACCGTTATATCTTACACTCACTGGCCGAGGAACTGGCC
GTTAACAACCGTTGCTACTCACCTGCGCGGTATTGGCCAGGCCACCAACCCCCAACAAAG
TGCTCAAATGCTTAAGTGGGAGGACTCTGAAGGCAATAATGGTCACATTACCCCTTATGT
CCTCCCCAATCTGCCAGTCAATCTCTGGGGAAGGGACATCCTCTCTCAAATGAAACTTGT
CATGTGCAGTCCCAACGATACTGTCATGACCCAAATGCTAAGCCAGGGGTATCTCCCCGG
CCAAGGGTTGGGAAAAAATAATCAAGGAATCACCCAGCCCATTACTATTACCCCCAAAAA
AGACAAAACAGGCCTAGGATTCCACCAAAATTTACCGTAGTCGTGCCATTGACATTCCTG
TACCCCACGCTGACAAAATTTCCTGGAAAATTACAGACCCTGTGTGGGTTGATCAGTGGC
CACTTACATATGAGAAAACCCTCGCTGCCATTGCGTTAGTACAGGAACAGCTCGCAGCAG
GACATATTGAGCCCACAAATTCTCCATGGAATACTCCTATATTCATCATTAAGAAAAAAT
CAGGTAGCTGGCGTCTTTTACAGGATCTAAGAGCCGTTAATAAGGTAATGGTCCCCATGG
GAGCCCTTCAGCCTGGTCTTCCCTCTCCTGTAGCCATCCCCCTAAACTATCACAAAATTG
TTATTGACCTTAAGGATTGTTTCTTTACCATCCCCTTACACCCTGAAGACAGACCTTACT
TTGCCTTTAGCGTCCCTCAAATCAACTTCCAAAGTCCTATGCCTCGTTATCAGTGGAAGG
TTCTGCCACAGGGCATGGCCAACAGTCCCACACTGTGCCAAAAATTTGTTGCTGCCGCCA
TTGCCCCAGTAAGATCCCAGTGGCCAGAGGCCTATATCCTCCATTATATGGATGACATCC
TTCTTGCTTGTGACAGCGCCGAGGCAGCCAAGGCCTGCTATGCTCACATTATATCCTGTC
TTACCTCATATGGACTAAAAATTGCTCCAGACAAGGTACAAGTGTCTGAGCCATTTTCTT
ATTTAGGATTTGAGTTACACCATCAGCAAGTATTTACTCCCCGAGTCTGCTTAAAAACTG
ATCACTTAAAAACCCTTAACGATTTCCAAAAATTACTCGGGGACATTCAGTGGCTTCGAC
CCTATTTAAAATTGCCCACCAGTGCCCTTGTTCCCCTTAACAATATTCTAAAAGGCGATC
CAAATCCTTTATCGGTTCGAGCACTGACCCCAGAGGCAAAGCAATCTCTAGCCCTCATCA
ACAAGGCTATCCAAAATCAAAGTGTTCAACAAATTTCGTATAACCTTCCCCTAGTACTCC
TCTTGCTCCCAACTCCCCATACACCCACCGCGGTGTTTTGGCAACCAAACGGTACAGACC
CTACAAAAAACGGAAGCCCCCTCCTTTGGCTCCATCTACCTGCCTCCCCATCAAAAGTCT
TACTCACCTACCCCTCGCTCCTCGCCATGTTAATTATTAAGGGTCGGTACACTGGCCGCC
AACTGTTTGGCAGGGACCCCCACTCTATAATCATTCCATACACCCAGGACCAATTAACCT
GGCTCCTGCAAACCTCTGACGAATGGGCCATTGCATTATCCTCCTTCACAGGAGACATAG
ACAATCATTACCCCAGTGACCCTGTTATCCAATTTGCCAAGCTTCACCAGTTCATATTCC
CCAAGATCACAAAATGTGCCCCAATTCCTCAAGCCACGCTAGTTTTCACTGATGGATCCT
CAAACGGAATTGCTGCATATGTTATTGATAATCAACCCATCTCAATAAAATCCCCCTACC
TGTCAGCTCAACTTGTTGAGCTCTATGCTATTCTCCAGGTGTTCACAGTTCTAGCTCACC
AACCGTTTAACTTGTACACTGACAGTGCGTATATTGCTCAATCAGTCCCTCTTTTGGAGA
CAGTCCCCTTTATCAAATCCTCAACCAATGCTACCCCCTTATTTTCTAAACTGCAACAGC
TAATTTTAAACAGACAACACCCTTTCTTTATCGGACATCTTCGGGCCCACCTAAATCTTC
CAGGACCCCTGGCTGAAGGCAATGCCTTAGCTGATGCTGCCACACAGATTTTCCCCATTA
TAAGTGACCCAATACATGAGGCTACTCAAGCTCACACCCTACATCACCTCAATGCACACA
CCCTACGATTACTCTATAAAATTACTAGAGAACAAGCCAGAGATATTGTAAAAGCTTGCA
AACAGTGTGTCGTAGCCACCCCTGTACCCCATCTTGGCGTGAACCCCCGTGGTTTAGTCC
CCAATGCCATTTGGCAAATGGATGTCACTCATTTTACTCCTTTTGGAAAACAGAGGTTTG
TTCATGTTACTGTTGACACATTTAGTGGTTTTATCTTAGCCACTCCCCAAACAGGTGAAG
CATCAAAAAATGTTATATCTCATGTTATCCACTGTCTTGCTACCATAGGAAAACCACACA
CCATTAAAACAGACAATGGCCCGGGATATACTGGAAAAAACTTCCAAGACTTTTGCCAAA
AACTCCAAATCAAACATGTTACTGGTATACCGTACAACCCCCAGGGTCAAGGAGTAGTTG
AACGAGCTCATCAAACATTAAAAAATGCCCTAAATCGCTTAGCCCGCTCCCCCCTTGGGT
TTTCTATGCAACAACCCAGAAACCTTCTTAGTCATGCCCTATTTCAACTAAATTTTCTAC
AGCTTGACAGTCAAGGGCGCTCGGCAGCTGACCGTCTATGGCATCCCCAAACTTCTCAGC
AGCATGCTACGGTTATGTGGCGTGACCCTCTCACCAGTGTTTGGAAGGGCCCTGACCCTG
TCCTCATATGGGGGCGAGGCTCAGCCTGCATATACGATCAAAAGGAGGATGGCCCCCGCT
GGCTCCCTGAGCGACTAATTAGACACATCAATAATCAGACAGCCCCCTTGTGTGACAGGC
CAAGTAACCCAAATACAGCCCCAGGGCCAAAAGGCTCGCCCTGAGGAGCTCCTTTTCTCT
TCTTCCAGGAAGAATGCTCTGCATCCTCATCCTCCTACTGCACCCACGCCTCTGCCCAGT
CACAAAGGGAGGACTTGGAAAGCCATCCGGAGACATTTACACTGCCCTCTTTGGAGCGCC
ATGTGACTGTAAAGGGGGGACTCAGACCAATAATTACGCCACCCCAACTTACACTCAGGT
AACAGATTGTGGGGACAAAAATGCCTATCTTACCTATGACACCAATTGGAATGGAGTATC
TTCACCTAAGTGGCTTTGTGTGCGCAAGCCTCCTAGTATACCGGTCATTAATGGCCGCCC
AGGCCCGTGCCCAAGCGAGTGCACAAACAACATTAAATCCCAGATGCACTCCTCCTGCTA
TTCTAGTTTCTCACAGTGTACTCAAGGCAATAATACTTATTTTACTGCCATTCTACAAAG
AACAAAGAGCACCTCAGAAACCAATCCTGTCACCAGCGGCCTACAACCTCATGGGGTCCT
CCAGGCCGGATGCGATGGCACGGTTGGAAAATCGGTTTGTTGGAATCAGCAAGCCCCTAT
TCACGTCTCCGACGGTGGCGGACCCCAAGATGCTGTGAGAGAGCTTTATGTACAAAAACA
AATAGAGCTTGTTATTCAAAGCCAATTCCCTAAGTTATCCTACCACCCCCTAGCTCGCTC
AAAACCAAGAGGACCTGACATTGATGCACAAATGCTTGATATTCTGTCAGCCACCCACCA
GGCCCTCAATATCTCCAACCCCAGCCTAGCCCAAAATTGCTGGTTATGCTTAAATCAAGG
TACCTCCATGCCCCTAGCCTTCCCTGTCAATATATCTAGTTTTAATGCCTCACAAAATAA
TTGCACCCCCAGCTTACCCTTTAGAGTCCAGCCCATGCCTTCCCAAGTATACCCTTGCTT
CTTTAAAGGTGCACAAAACAACAGCTTTGATATTCCGGTTGGCGTTGCCAACTTTGTAAA
CTGCTCCAGTAGTTCCAACCACAGTGAGGCCCTTTGCCCTGGCCCAGGCCAAGCTTTTGT
TTGCGGCAACAACCTCGCCTTTACTGCTCTGCCTGCAAACTGGACAGGGTCATGTGTGTT
AGCCGCCCTCCTGCCAGATATAGACATTATTTCTGGTGATGACCCTGTCCCTATCCCTAC
CTTTGACTATATTGCAGGGCGGCAGAAACGAGCCGTTACACTGATTCCCCTGCTAGTAGG
ATTGGGTGTCTCTACAGCAGTCGCTACCGGTACAGCAGGACTCGGGGTGGCTGTTCAATC
TTACACAAAACTTTCCCATCAACTTATTAACGACGTCCAAGCCTTGTCTAGCACCATTAA
TGACTTACAGGACCAACTAGATTCCCTAGCCGAAGTAGTCCTCCAAAACAGAAGAGGCTT
AGACCTACTCACTGCAGAACAGGGAGGTATCTGTTTGGCTCTACAGGAACGTTGCTGCTT
TTATGCCAACAAGTCAGGAATTGTCCGAGATAAAATAAAAAATCTACAAGAAGACCTCGA
AAAAAGACGCAAGGCACTTGCAGACAATCTCTTCCTCACCGGCCTCAATGGACTTCTCCC
TTACCTCCTCCCCTTCCTTGGACCCTTATTCGCTATCATCCTGTTCTTCTCTTTTGCCCC
TTGGATCCTAAGACGAGTAACAGCGTTAATCAGGGATCAGCTCAATTCCCTACTGGGAAA
GCCCATACAAATCCACTATCACCAACTAGCAACGCGTGATCTAGAATATGGCAGACTGTA
GCCGGTTCCCCTCCTACGGGAGCAGCATACCGCTCGACACTATGCTTTACGAAGGTAATG
GACACCGCTAGGTGCAAGGCAAGGCACTGCAAGGAGAGGCCTTACTAAGGCTACTGTCGA
GTCTCCTGAGAGGTAAGCTGGCTTGCATAGAGGTTGGTACTCGAAAAATCCTCTCCTCCC
AAAAAGGTACCTGTAAGCCTGAAAATTAAGGCTCAGGAGGAGCACAGCCTCTACCTCCCC
TAGCTGGTTAAGGTCCGCCTCCTCTTTTTTTAAAGAAAAAGGGAGGAGATGTTGGGAACC
CAGGCTAAGCTGATGCTATTGGAACAAAAGGTTGCATCAGCCCTCCCCGCCAAAAGCATG
CCCCGGGCGTGGTGGCGGGCCACCAATGGAGGACCTGATCACGGGCAAGACATGCCTCAG
GGCCACCAATGGAGGACCTGATCACGGGCAAGACATGCCTCAGGGCCACCAATAAAGGAC
CTGATCACGCACAGAACATGCATGGCTGCACCAATGGGGTAGCTGATCATGAGCTAAACA
CTCGTCTCCCAGCCTATCAGAACTACTTCCCCTTTCCCCTCTCTACCCGCTCCCCTCCCT
ATATAAGGAACCCATTTTGAAATAAACTTTGCAGCTTGATCAGAACTTTTGTCTTGCTGC
CATTCTTCGCGCCTCTTGTCCCATCCCTTTCTCATCCACGACAGGCTTGCTCGGGTTCCT
GTTTGTTGCTCTGCGGGACAGAGCA