>M60677|Duck hepatitis B virus, complete genome.
catgctcatttgaaagcttatgcaaaaattaacgaggaatcactggatagggctaggaga
ttgctttggtggcattacaattgtttactgtggggagaagctcaagttactaactatatt
tctcgcttgcgtacttggttgtcaactcctgagaaatatagaggtagagatgccccgacc
attgaagcaatcactagaccaatccaagtggctcagggaggccgaaaaacaactacgggt
actagaaaacctcgtggactcgaacctagaagaagaaaagttaaaaccacagttgtctat
gggagaagacgttcaaagtcccgggaaaggagagcccctacaccccaacgtgcgggctcc
cctctcccacgtagttcgagcagccaccatagatctccctcgcctaggaaataaattacc
tgctaggcatcacttagggaaattgtcaggactgtatcaaatgaagggctgtacatttaa
cccagaatggaaagtaccagatatttcggatactcattttaatttagatgtagttaatga
gtgcccttcccgaaattggaaatatttgactccagccaaattctggcccaagagcatttc
ctactttcctgtccaggtaggggttaaaccaaagtatcctgacaatgtgatgcaacatga
atcaatagtaggtaaatatttaaccaggctctatgaagcaggaatcctttataagcggat
atctaaacatttggtaacatttaaaggtcagccttataattgggaacagcaacaccttgt
caatcaacatcacatttatgatggggcaacatccagcaaaatcaatggacgtcagacgga
tagaaggaggagaaatactgttaaaccaacttgccggaaggatgatcccaaaagggactt
tgacatggtcaggcaagtttccaacactagatcacgtattagaccatgtgcaaacaatgg
aggagataaacaccctccagaatcagggagcttggcctgctggggcgggaaggagagtag
gattatcaaatccgactcctcaagagattcctcagccccagtggactcccgaagaagacc
aaaaagcacgcgaagcttttcgccgttatcaagaagaaagaccaccggagaccaccacca
ttccgccgtcttcccctcctcagtggaagctacaacccggggacgatccactcctgggaa
atcagtctctcctcgagactcatccgctataccagtcagaaccagcggtgccagtgataa
aaactccccccttgaagaagaaaatgtctggtaccttcgggggaatactagctggcctaa
tcggattactggtaagctttttcttgttgataaaaattctagaaatactgaggaggctag
attggtggtggatttctctcagttctccaaagggaaaaatgcaatgcgctttccaagata
ctggagcccaaatctctccacattacgtaggatcctgcccgtggggatgcccaggatttc
tttggacctatctcaggctttttatcatcttcctcttaatcctgctagtagcagcaggct
tgctgtatctgacggacaacgggtctactattttaggaaagctccaatgggcgtcggtct
cagcccttttctcctccatctcttcactactgccctcggatccgaaatctctcgtcgctt
taacgtttggactttcacttatatggatgacttcctcctctgccacccaaacgctcgtca
ccttaacgcaattagccacgctgtctgctcttttttacaagagttaggaataagaataaa
ctttgacaaaaccacgccatctccggtaaatgaaataagattcctcggttaccagattga
tgaaaatttcatgaagattgaagaaagcagatggaaagaattaaggactgtaatcaagaa
aataaaagtaggagaatggtatgactggaaatgtattcaaagatttgttgggcatttgaa
ttttgtcttgccttttactaaaggtaatattgaaatgttaaaaccaatgtatgctgctat
tactaaccaagtaaactttagcttctcttcatcttataggactttgttatataaactaac
aatgggtgtgtgtaaattaagaataaagccaaagtcctctgtacctttgccacgtgtagc
tacagatgctaccccaacacatggcgcaatatcccatatcaccggcgggagcgcagtgtt
tactttttcaaaggtcagagatatacatgttcaggaactattgatgtcttgtttagctaa
gataatgattaaaccacgttgtctcttatctgattcaacttttgtttgccataagcgtta
tcagacgttaccatggcattttgctatgttggccaaacaattgctcaaacctatacaatt
gtactttgtcccgagcaaatataatcctgctgacggcccatccaggcacaaacctcctga
ttggacggcttttccatacacccctctctcgaaagcaatatatattccacataggctatg
tggaacttaagaattacacccctctccttcggagctgcttgccaaggtatctttacgtct
acattgctgttgtcgtgtgtgactgtacctttggtatgtaccattgtttatgattcttgc
ttatatatggatatcaatgcttctagagccttagccaatgtgtatgatctaccagatgat
ttctttccaaaaatagatgatcttgttagagatgctaaagacgctttagagccttattgg
aaatcagattcaataaagaaacatgttttgattgcaactcactttgtggatcttattgaa
gacttctggcagactacacagggcatgcatgaaatagccgaatccttaagagctgttata
cctcccactactactcctgttccaccgggttatcttattcagcacgaagaagctgaagag
atacctttgggagatttatttaaacaccaagaagaaaggatagtgagtttccaacccgac
tatccaattacggctagaatt