>AY622909|Small anellovirus 2, complete genome.
ctatataaccaagtggggtggcgaatggctgagtttaccccgctagacggtgcagggacc
ggatcgagcgcagcgaggaggtcccaggctgcccatgggcgggagcccgaggtgagtgaa
accaccgaggtctaggggcaattcgggctagggcagtctagcggaacgggcaagaaactt
aaatatattttatttcagatgctgtgtgccaaagactacttcacccaaacagactacaat
actgaaaccaaaaatcaactatggatgtcaatgatagctgattctcatgatattcactgc
aaatgccacactccatttgcacaccttttggcaagtatttttccaccaggtcacagtgac
agagaactaactattaaccaaattcttaccagagacttcaaggaactaagatgcctttct
ggtggaggaggagaaaaaggttttggaaaagaagaaacccatacttcaagagaaagaatt
acagaaaaagaaaacctatacgtagaagacgaagaactaagagaattcatcgccgccgca
gaagacgccgccggtacaaggtaagaagaaaaaaacaaaaaattcctatctatcaatggc
aaccagactctattagaaaatgtaaaattaaaggtgttggagttctagtactaggagcac
atggaaaacaatttgtatgctatactgatgtgcagcaaaaagcaccacctcccagatcac
ctggaggaggaggttttgcctgccaacagttcagtctccagctactatatgaacaataca
aatttagaaacaatatctggactcatactaatataaactatgaccttgtgagatatataa
gaactgtctttactttttacagacactcagacatagactttattataacatatgacagac
aaccaccatttatattagataagcttacatatccactatgtcacccacaaacttactgct
aggtaaacacaaaattttaatacttagtaaaaacacaaaaccaaatggaaaactaaaaaa
gagagtagtcattaaacctccaaagcaaatgctaacaaaatggttttttcaagagcaatt
ctccaatgctcctttactaagcttaagagcagcagcttgcagctttacatacccacatat
cagcccactagcacaaaaccaagtgttaactttctcttgtttaaacccaggattttatca
acagggcaactgggcttatgctcaagcccaaaccagtccatattcaccatatattggcat
acctagaaatttagtattctgggatgtaacacaaagagaagtagtagaggccaaaaaaca
aacagacacatgggaagcttataaaaagaaacactgcttccaacctaatatacactccta
tgatgattctattagctataaacaaggatactttagtacaaaagttcttacagctaaatt
tgtaggcagagacacagaagacctcactggcattgccaacacaccactaaacatatgtag
atataatcctaacatagacacaggcaaaggaaacatagcttggctacacagcaacctaac
tacatcatatgacaaacccacatcagaccaagacattataattcaaggaatgccaatatg
gatgatgctatatggctggttaagctgggtacaacatgttaaaacagctccagattttta
cttatcatacacactatgtcttcaaagtcctgcactagaagtagcaacaaaaggaacaac
catactaccagttattccattagataatacttttataaaaggaaatgcaccatacaacca
aatactaaccaacaaagactacacacactggtacccagacatatacaaccaaacagaaat
cataaacagctttgtaacttcaggaccctatgtaccaaagcttgaaaatgttacaaacag
ttcttgggaactccactattcatataactttctttttaagtggggaggacctgaacaaac
tgaaacaccagttgcagacccatccaaacaaccagtatatgatgccctcgataaacagca
acaaacaatacaaattaggaacccagcaaaacaaaaatatgctaccattatgcatccctg
ggatgtcagaaggggaatcattacaaacaaagctcttaaaagaatgtatgaaaacctctc
aattgattcaactttcgaagcagatagcactacctccaaaaaaaggagagttacaggccc
ttgctttacagccctccaagaaatcaaccaagaagaaacatcatgtctccaggagctctg
caaagaaaatatcttccaagaaacgccgcaagaggaaaacctccagcagctcatcctcca
gcagcagcaacagcagcaagacatcaaatacaacctcctcaaattaatatcctacatgaa
agaacaacaaaacatgttaaaacttcacacaggaatgttaccctaacccgctttgctcca
ggctttgaacaagaaacagaaagagacttagctattgcctttaaaagacccatgagaacc
tttaaagaagacacccccttttacccctggttaccaccagaacccactgtaaattttcac
cttaatttcaaattaaaacctgccacgtcacagtaagtgggaggagactttaaaa