>AY594255|Human adenovirus type 7 strain Gomen, complete genome.
ctatctatataatataccttatagatggaatggtgccaacatgtaaatgaggtaatttaa
aaaagtgcgcgctgtgtggtgattggctgtggggtgaatgactaacatggggcggggcgg
ccgtgggaaaatgacgtgacttatgtgggaggagttatgttgcaagttattgcggtaaat
gtgacgtaaaaggaggtgtggtttgaacacggaagtagacagttttcccacgcttactga
taggatatgaggtagttttgggcggatgcaagtgaaaattctccattttcgcgcgaaaac
tgaatgaggaagtgaatttctgagtcatttcgcggttatgacagggtggagtatttgccg
agggccgagtagactttgaccgtttacgtggaggtttcgattaccgtgtttttcacctaa
atttccgcgtacggtgtcaaagtcctgtgtttttacgtaggtgtcagctgatcgctaggg
tatttaaacctgacgagttccgtcaagaggccactcttgagtgccagcgagaagagtttt
ctcctccgcgccgcaagtcagttctgcgctttgaaaatgagacacctgcgcttcctgcca
caggagattatctccagtgagaccgggatcgaaatactggagtttgtggtaaatacccta
atgggagacgacccggaaccgccagtgcagccttttgatccacctacgctgcacgatctg
tatgatttagaggtagacgggccggaggatcccaatgagggagctgtgaatgggtttttt
actgattctatgctgctagctgccgatgaaggattggacataaaccctcctcctgagacc
cttgtcaccccaggggtggttgtggaaagcggcagaggtgggaaaaaattgcctgatctg
ggagcagctgaaatggacttgcgttgttatgaagagggttttcctccgagtgatgatgaa
gatggggaaactgagcagtccatccataccgcagtgaatgagggagtaaaagctgccagc
gatgtttttaagttggactgtccggagctgcctggacatggctgtaagtcttgtgaattt
cacaggaataacactgggatgaaagaactattgtgctcgctttgctatatgagaatgcac
tgccactttatttacagtaagtgtatttaagtgaaatttaaaggaatagtgtagctgttt
aataactgttgaatggtagatttatgtttttacttgcgattttttgtaggtcctgtgtct
gatgatgagtcaccttctcctgattcaactacctcacctcctgaaattcaggcgcccgca
cctgcaaacgtatgcaagcccattcctgtaaagcctaagcctgggaaacgccctgctgtg
gataagcttgaggacttgttggagggtggggatggacctttggaccttagtacccggaaa
ctgccaaggcaatgagtgccctgcagctgtgtttatttaatgtgacgtcatgtaataaaa
ttatgtcagctgctgagtgttttattacttcttgggtggggtcttggatatataagtagg
agcagatctgtgtggttagctcacagcaacttgctgccatccatggaggtttgggctatc
ttggaagacctcagacagactaggctactactagaaaacgcctcggacggagtctctggc
ctttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggac
tacagggaagaatttgaaaagttattggacgacattccaggactttttgaagctcttaac
ttgggccatcaggctcattttaaggagaaggttttatcagttttagatttttctactcct
ggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaa
actcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatgg
aaggctcgcaggatgaggacaatcttagattactggccagtgcagcctctgggagtagca
gggatactgagacacccaccgaccatgccagcggttctgcaggaggagcagcaggaggac
aatccgagagccggcctggaccctccggtggaggagtagctgacctgtttcctgaactgc
gacgggtgcttactaggtctacgaccagtggacagaacaggggaattaagagggagagga
atcctagtgggaataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtc
ctgaaactgtttggtggcatgaggttcagagcgaaggcagggatgaagtttcaatattgc
aggagaaatattcactagaacaacttaagacctgttggttggaacctgaggatgattggg
aggtggccattaggaattatgctaagatatctctgaggcctgataaacaatatagaatta
ctaagaagattaatattagaaatgcatgctacatatcagggaatggggcagaggttataa
tagatacacaagataaagcagcttttagatgttgtatgatgggtatgtggccaggggttg
tcggcatggaagcaataacacttatgaatattaggtttagaggggatgggtataatggca
ttgtatttatggctaacactaagctgattctacatggttgtagcttttttgggtttaata
atacgtgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgcatgct
ggattgcaacatcaggtagggtgaagagtcagttgtctgtgaagaaatgcatgtttgaga
gatgtaatcttggcatactgaatgaaggtgaagcaagggtccgccactgcgcagctacag
aaactgcctgcttcattctaataaagggaaatgccagtgtgaagcataatatgatctgtg
gacattcggatgagaggccttatcagatgctaacctgcgctggtggacattgcaatattc
ttgctaccgtgcatatcgtttcacatgcacgcaagaaatggcctgtatttgaacataatg
tgattaccaagtgcaccatgcatataggtggtcgcaggggaatgtttatgccttaccagt
gtaacatgaatcatgtgaaggtaatgttggaaccagatgccttttccagagtgagcgtaa
caggaatctttgatatgaatattcaactatggaagatcctgagatatgatgacactaaac
caagggtgcgcgcatgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtgg
atgtgactgaagacctgaggcccgatcatttggtgcttgcctgcactggagcggagttcg
gttctagtggtgaagaaactgactaaagtaagtagtgggggcaaaatgtggatggggact
ttcaggttggtaaggtggacaaattgggtaaattttgttaatttctgtcttgcagctgcc
atgagtggaagcgcttcttttgaggggggagtatttagcccttatctgacgggcaggctc
ccaccatgggcaggagttcgtcagaatgtcatgggatccactgtggatgggagacccgtc
cagcccgccaattcctcaacgctgacctatgccactttgagttcgtcaccattggatgca
gctgcagccgccgccgctactgctgccgccaacaccatccttggaatgggctattacgga
agcattgttgccaattccagttcctctaataatccttcaaccctggctgaggacaagcta
cttgttctcttggctcagctcgaggccttaacccaacgcttaggcgaactgtctaagcag
gtggcccagttgcgtgagcaaactgagtctgctgttgccacagcaaagtctaaataaaga
tctcaaatcaataaataaagaaatacttgttataaaaacaaatgaatgtttatttgattt
ttcgcgcgcggtatgccctggaccatcggtttcgatcattgagaactcggtggatctttt
ccagtaccctgtaaaggtgggattgaatgtttagatacatgggcattagtccgtctcggg
ggtggagatagctccattgaagagcctcttgctccggggtagtgttataaatcacccagt
catagcaaggtcggagtgcatggtgttgcacaatatcttttaggagcagactaattgcaa
cggggaggcccttagtgtaggtgtttacaaatctgttgagctgggacgggtgcatccggg
gtgaaattatatgcattttggactggatcttgaggttggcaatgttgccgcctagatccc
gtctcgggttcatattgtgcaggaccaccaagacagtgtatccggtgcacttgggaaatt
tatcatgcagcttagagggaaaagcatgaaaaaatttggagacgcctttgtgacccccca
gattctccatgcactcatccataatgatagcgatggggccgtgggcagcggcacgggcga
acacgttccgggggtctgaaacatcatagttatgctcctgagtcaggtcatcataagcca
ttttaataaactttgggcggagggtgccagattgggggatgaaagttccctgtggcccgg
gagcatagtttccctcacatatttgcatttcccaggctttcagttcagagggggggatca
tgtccacctgcggggctataaaaaataccgtttctggagccggggtgattaactgggatg
agagcaaattcctaagcagctgagacttgccgcacccggtgggaccgtaaatgaccccaa
ttacgggttgcagatggtagtttagggagcgacagctgccgtcctcccggagcagggggg
ccacttcgttcatcatttcccttacatggatattttcccgcaccaagtccgttaggaggc
gctctcccccaagtgatagaagctcctggagcgaggagaagtttttcagcggcttcagcc
cgtcagccatgggcattttggaaagagtctgttgcaagagctcgagccggtcccagagct
cggtgatgtgctctatggcatctcgatccagcagacctcctcgtttcgcgggttgggacg
gctcctggagtagggaatcagacgatgggcgtccagcgctgccagggtccgatccttcca
tggtcgcagcgtccgagtcagggttgtttccgtcacggtgaaggggtgcgcgcctggttg
ggcgcttgcgagggtgcgcttcagactcatcctgctggtcgagaaccgctgccgatcggc
gccctgcatgtcggccaggtagcagtttaccataagttcgtagttgagcgcctcggccgc
gtggcctttggcacggagcttacctttggaagttttatggcaggcagggcagtagataca
tttgagggcatacagcttgggcgcgaggaaaatggattcgggggagtatgcatccgcacc
gcaggagacgcagacggtttcgcactccacaagccaggtcagatccggctcatcagggtc
aaaaacaagttttccgccatgttttttgatgcgtttcttacctttggtttccatgagttc
gtgtccacgctgggtgacaaagaggctgtccgtgtccccgtagaccgactttatgggcct
gtcctcgagcggagtgcctcggtcctcttcgtagaggaatccagcccactctgatacaaa
agcgcgtgtccaggccagcacaaaggaggccacgtgggaggggtagcggtcgttgtcaac
caggggatccaccttctctacggtatgtaaacacatgtccccctcctccacatccaagaa
tgtgattggcttgtaagtgtaggccacgtgaccaggggtccccgccgggggggtataaaa
gggggcggacctctgttcgtcctcactgtcttccggatcgctgtccaggagcgccagctg
ttggggtaggtattccctctcgaatgcgggcatgacctctgcactcaggttgtcagtttc
taggaacgaggaggatttgatattgacagtaccagcagagatgccttttataagactctc
gtccatctggtcagaaaacacaatcttcttgttgtccagcttggtggcaaatgatccata
gagggcattggatagaagcttggcgatggagcgcatggtttggttcttttccttgtccgc
gcgctccttggcggcgatgttaagctggacgtactcgcgcgccacacatttccattcagg
aaagatggttgtcagttcatccggaactattctgactcgccatcccctattgtgcagggt
tatcagatccacactggtggccacctcgcctcggaggggctcattggtccagcagagtcg
acctccttttcttgaacagaaaggggggagggggtctagcatgaactcatcaggggggtc
cgcatctatggtaaatattcccggtagcaaatctttgtcaaaatagctgatggtggcagg
atcatccaaggtcatctgccattctcgaactgccagcgcgcgctcataggggttaagagg
ggtgccccagggcatggggtgggtgagcgcggaggcatacatgccacagatatcgtagac
atagaggggctcttcgaggatgccgatgtaagtgggataacagcgcccccctctgatgct
tgctcgcacatagtcatagagttcatgtgagggggcgagaagacccgggcccagattggt
gcggttgggtttttccgccctgtaaacgatttggcgaaagatggcatgggaattggaaga
aatagtaggtctctggaatatgttaaaatgggcatgaggtaggcctacagagtctcttat
gaagtgggcatatgactcttgcagcttggctaccagctctgcggtgacgagtacatccag
ggcacagtagttgagagtttcctggatgatgtcataacgcggttggcttttcttttccca
cagctcgcggttgagaaggtattcttcgtgatccttccagtactcttcgaggggaaaccc
gtctttttctgcacggtaagagcccaacatgtagaactgattgactgccttgtagggaca
gcatcccttctccactgggagagagtatgcttgggctgcattgcgcagcgaggtatgagt
gagggcaaaagtgtccctgaccatgactttgaggaattgatacttgaagtcgatgtcatc
acaggccccctgttcccagagttggaagtccgcccgcttcttgtaggcgggattgggcaa
agcgaaagtaacatcattgaagaggatcttgccggccctgggcatgaaatttcgggtgat
tttaaaaggctgagggacctctgctcggttattgataacctgagcggccaagacgatctc
atcaaagccattgatgttgtgccccactatgtacagttctaagaatcgaggggtgcccct
gacatgaggcagcttcttgagttcttcaaaagtgagatctgtagggtcagtgagagcata
gtgttcgagggcccattcgtgcatgtgagggttcgctttgaggaaggaggaccagaggtc
cactgccagtgctgtttgtaactggtcccggtactgacgaaaatgctgtccgactgccat
cttttctggggtgatgcaatagaaggtttgggggtcctgccgccagcgatcccacttgag
tttcatggcgatgtcataggcgatgttaacgagccgctggtctccagagagtttcatgac
cagcatgaaggggattagctgcttgccaaaggaccccatccaggtgtaggtttccacatc
gtaggtgaggaagagcctttctgtgcgaggatgagagccaatcgggaagaactggatttc
ctgccaccagttggaggaatggctgttgatgtgatggaagtagaactccctgcgacgcgc
cgagcattcatgcttgtgcttgtacagacggccgcagtactcgcagcgattcacgggatg
cacctcatgaatgagttgtacctgacttcctttgacgagaaatttcagtggaaaattgag
gcctggcgcttgtacctcgcgctctactatgttgtctgcatcggcatgaccatcttctgt
ctcgatggtggtcatgctgacgagccctcgcgggaggcaagtccagacctcggcgcggca
ggggcggagctcgaggacgagagcgcgcaggccggagctgtccagggtcctgagacgctg
cggagtcaggttagtaggcagtgtcaggagattgacttgcatgatcttttcgagggcgtg
agggaggttcagatggtacttgatctccacgggtccgttggtggagatgtcgatggcttg
cagggttccgtgccccttgggcgctaccaccgtgcccttgtttttccttttgggcggcgg
tggctctgttgcttcttgcatgtttagaagcggtgtcgagggcgcgcaccgggcggcagg
ggcggctcgggacccggcggcatggctggcagtggtacgtcggcaccgcgcgcgggtagg
ttctggtactgcgccctgagaagactcgcatgcgcgacgacgcggcggttgacatcctgg
atctgacgcctctgggtgaaagctaccggccccgtgagcttgaacctgaaagagagttca
acagaatcaatctcggtatcgttgacggcggcttgcctaaggatttcttgcacgtcgcca
gagttgtcctggtaggcgatctcggccatgaactgctcgatctcttcctcttgaagatct
ccgcggcccgctctctcgacggtggccgcgaggtcgttggagatgcgcccaatgagttga
gagaaagcattcatgcccgcctcgttccagacgcggctgtagaccacagcccccacggga
tctctcgcgcgcatgaccacctgggcgaggttgagctccacgtggcgggtgaagaccgca
tagttgcataggcgctggaaaaggtagttgagtgtggtggcgatgtgctcggtgacgaag
aaatacatgatccatcgtctcagcggcatctcgctgacatcgcccagcgcttccaagcgc
tccatggcctcgtagaagtccacggcaaagttgaaaaactgggagttacgcgcggacacg
gtcaactcctcttccagaagacggataagttcggcgatggtggtgcgcacctcgcgctcg
aaagctcctaggatttcttcctcaatctcttcttcttccactaacatctcttcctcttca
ggtggggctgcaggaggagggggaacgcggcgacgccggcggcgcacgggcagacggtcg
atgaatctttcaatgacctctccgcggcggcggcgcatagtctcggtgacggcacgaccg
ttctccctgggtctcagagtgaagacgcctccgcgcatctccctgaagtggtgactggga
ggctctccgttgggcagggacaccgcgctgattatgcattttatcaattgccccgtaggt
actccgcgcaaggacctgattgtctcaagatccacgggatctgaaaacctttcgacgaaa
gcgtctaaccagtcgcaatcgcaaggtaggctgagcactgtttcttgcgggcgggggcgg
ctagacgctcggtcggggttctctctttcttctccttcctcctcttgcgagggtgagacg
atgctgctggtgatgaaattaaaataggcagttttaagacggcggatggtggcgaggagc
accaggtctttgggtccggcttgttggatgcgcaggcgatgagccattccccaagcatta
tcctgacatctggccagatctttatagtagtcttgcatgagtcgttccacgggcacttct
tcttcgcccgccctgccatgcatgcgagtgatcccgaacccgcgcatgggctggacaagt
gccagatccgctacaaccctttcggcgaggatggcttgctgcacctgggtgagggtggct
tgaaagtcgtcaaagtccacgaagcggtggtaggccccggtgttgattgtgtaggagcag
ttggccatgactgaccagttgactgtctggtgcccagggcgcacgagctcggtgtacttc
aggcgcgagtatgcgcgcgtgtcaaagatgtaatcgttgcaggtgcgcaccaggtactgg
tagccgatgagaaagtgtggcgatggctggcggtacaggggccatcgctctgtagccggg
gctccgggggcgaggtcttccagcatgaggcggtggtagccgtagatgtacctggacatc
caggtgataccggaggcggtggtggatgcacgtgggaactcgcgcacgcggttccagatg
ttgcgcagcggcatgaagtagttcatggtaggcacggtctggccagtgaggcgcgcgcag
tcattgacgctctgtagacacggagaaaacgaaagcgatgagcggctcgactccgtggcc
tgggggaacgtgaacgggttgggtcgcggtgtaccccggttcgagtccaaagctaagcaa
tcacactcggatcggccggagccgcggctaacgtggtattggctatcccgtctcgaccca
gccgacgaatatccagggtacggagtagagtcgtttttgctgcttttttcctggacgtgt
gccattgccacgtcaagctttacaacgctcagttctcgggccgtgagtggctcgcgcccg
tagtctggagaatcagtcgccagggttgcgttgcggtatgcccccggttcgagcctaagc
gcggctcgtatcggccggtttccgcgacaagcgagggtttggcagcccagtcatttccaa
gaccccgccagccgacttctccagtttacgggagcgagcccttttttttttttgtttttg
tcgcccagatgcatccagtgctgcgacagatgcgcccccagcaacaggccccttctcagc
aacagccacaaaaggctcttcttgctcctgcaactactgcagctgcagccgtgagcggcg
cgggacagcccgcctatgatctggacttggaagagggcgagggattggcgcgcctggggg
ctccatcgcccgagcggcacccgcgggtgcaactaaaaaaggactctcgcgaggcatacg
tgccccagcagaacctgtttagggacaggagcggcgaggagccagaggagatgcgagcat
ctcgatttaacgcgggtcgcgagctgcgccacggtctggatcgaagacgggtgctgcaag
acgaggattttgaggtcgatgaagtcacagggatcagcccagctagggcacatgtggccg
cggccaacctagtctcggcctacgagcagaccgtgaaggaggagcgcaacttccaaaaat
cttttaacaaccatgtgcgcaccctgattgcccgcgaggaagtgaccctgggtctgatgc
atctgtgggacctgatggaggctatcgcccaaaaccccactagcaaaccactgacagctc
agctgtttctggtggttcaacatagcagggacaacgaggcattcagggaggcgttgttga
acatcaccgagcctgatgggagatggctgtatgatctgatcaacatcctgcaaagtatta
tagtgcaggaacgtagcctgggtttggctgagaaagtggcagctatcaactactcggtct
tgagcctgggcaaatactacgctcgcaagatctacaagaccccctacgtacccatagaca
aggaggtgaagatagatgggttttacatgcgcatgactctaaaggtactaactctaagcg
acgatctgggggtgtatcgcaatgacaggatgcatcgcgcggtgagcgccagtaggaggc
gcgagctgagcgacagagaacttatgcacagcttgcaaagagctctaacgggggccggga
ctgatggggagaactactttgacatgggagcggacttgcaatggcaacccagtcgcaggg
ccatggaggctgcagggtgtgagcttccttacatagaagaggtggatgaagtcgaggacg
aggagggcgagtacttggaagactgatggcgcgacccgtatttttgctagatggaacagc
agcaggcaccggaccccgcaatgcgggcggcgctgcagagccagccgtccggcattaact
cctcggacgattggacccaggccatgcaacgcataatggcgctgacgacccgcaaccccg
aagcctttagacagcaaccccaggccaaccgcctttcggccatactggaggccgtagtgc
cctcccgctccaaccccacccacgagaaggtcctggctatcgtgaacgcgctggtggaga
acaaggccatccgtcccgatgaggccgggctggtatacaatgctctcttggagcgcgtgg
cccgttacaacagcagcaacgtgcaaaccaacctggaccggatggtgaccgatgtgcgcg
aggccgtgtctcagcgcgagcggttccagcgcgacgccaacttggggtcgttggtagcgc
taaacgcttttctcagcacccagcccgccaacgtgccccgtggtcagcaagactatacaa
actttttgagtgcattgagactcatggtagctgaggtgccccagagcgaggtgtaccagt
ccgggccagattacttcttccagaccagcagacagggcttgcagacagtgaacctgactc
aggctttcaaaaacctgaagggtctctggggagtgcacgccccagtaggggatcgcgcga
ccgtgtctagcttgctgactcccaactcccgcctgctgctgctgctggtatcccccttta
ctgacagcggtagcatcgaccgcaactcctacttgggctacctgcttaacctgtatcgcg
aggccataggacagagccaggtggacgaacagacctatcaagaaatcacccaagtgagcc
gcgccctgggtcaggaagacacgggcagtttggaagccaccctgaacttcttgttaacca
accggtcgcagaagatccctcctcagtatgcgcttaccgctgaggaggagcggatcctta
gatacgtgcaacagagcgttggattgttcctgatgcaggagggggcgacacctaccgccg
cgctggacatgacagctcgaaacatggagcccagcatgtatgctagtaacaggcctttca
ttaacaaactgctggactacctgcacagggcggccgccatgaactctgattatttcacca
atgctatcctgaacccacactggctgcccccacctggtttctacactggcgagtacgaca
tgcccgaccccaatgacgggttcctgtgggacgatgtagacagcagcatattctccccgc
ctcccggttatacagtttggaagaaggaagggggcgatacaaggcactcttccgtgtcgc
tgtccagaacggctggtgctgccgcgaccgtgcccgaagctgcaagtcctttccctagct
tgcccttttcactaaacagcgttcgcagcagtgaacttgggagaataacccgcccgcgct
tgatgggcgaggatgagtacttgaatgactctttgttgaggccagagagggaaaagaact
tccccaacaatggaatagagagcctggtggataagatgagtagatggaagacctatgcgc
aggatcacagagacgagcccaaaatcttgggggctacaagcagaccgacccgtagacgcc
agcgccacgacaggcagatgggtcttgtgtgggacgatgaggactctgccgatgatagca
gcgtgttggacttgggtggaagaggagggggcaacccgttcgctcatctgcgtcccagat
tcgggcgcatgttgtaaaagtgaaagtaaaataaaaaggcaactcaccaaggccatggcg
accgagcgtgcgttcgttcttttttgttatctgtgtttagtacgatgaggagacgagccg
tgctaggcggagcgatggtgtatccggagggtcctcctccttcttacgagagcgtgatgc
agcaacaggcggcgatgatacagcccccactggaggctcccttcgtacccccgcggtacc
tggcgcctacggaagggagaaacagcattcgttactcggagctgtcgcccctgtacgata
ccaccaagttgtatctggtggacaacaagtcggcggacatcgcctccctgaactatcaga
acgaccacagcaacttcctgaccacggtggtgcagaacaatgactttacccccacggagg
ctagcacccagaccatcaactttgacgagcggtcgcgatggggcggtcagctgaagacca
tcatgcacaccaacatgcccaacgtgaacgagtacatgttcagcaacaagttcaaggcga
gggtgatggtgtccagaaaggctcctgaaggtgttatagtaaatgacacctatgatcata
aagaggatatcttaaagtatgagtggtttgagttcactttaccagaaggcaacttctcag
ccaccatgaccattgacctgatgaacaatgccatcattgacaactacctggaaattggca
gacaaaatggagtgctggaaagtgacattggtgttaagtttgacactagaaactttaggc
tcgggtgggaccccgaaactaagttaattatgccaggagtctacacttatgaggcattcc
atcctgacattgttttgctgcctggctgcggggtagactttactgaaagccgacttagca
acttgcttggcatcaggaaaagacatccattccaggagggtttcaaaatcatgtatgaag
atcttgaagggggtaatattcctgcccttttggatgtcactgcctatgaggaaagcaaaa
aggataccactactgaaacaaccacactggctgttgcagaggaaactagtgaagatgata
atataactagaggagatacctatataactgaaaaacaaaaacgtgaagctgcagctgctg
aagttaaaaaagagttaaagatccaacctctagaaaaagacagcaagagtagaagctaca
atgtcttggaagacaaaatcaacacggcctaccgcagctggtacctgtcctacaattacg
gtaaccctgagaaaggaataaggtcttggacactgcttaccacttcagatgtcacctgtg
gggcagagcaggtctactggtcgctccctgacatgatgcaagacccagtcaccttccgct
ccacaagacaagtcaacaactacccagtggtgggtgcagagcttatgcccgtcttctcaa
agagtttctacaatgagcaagccgtgtactctcagcagctccgacaggccacttcgctca
cgcacgtcttcaaccgcttccctgagaaccagatcctcatccgcccgccggcgcccacaa
ttaccaccgtcagtgaaaacgttcctgctctcacagatcacgggaccctgccgttacgca
gcagtatccggggagtccagcgcgtgaccgttactgacgccagacgccgcacctgtccct
acgtttacaaggccctgggcatagtcgcgccgcgcgttctttcaagccgcactttttaaa
aaacaaaaaatgtccattctcatctcgcccagtaataataccggttggggactgtatgcg
cccaccaagatgtatggaggcgcccgcatacgctctacccagcaccctgtgcgcgttcgc
ggtcatttccgcgctccatggggcgcactcaagggtcgtacccgcactcggaccacggtc
gatgatgtgatcgaccaggtggtcgccgatgctcgtaattatactcctactgcgcctaca
tctactgtggatgcagttattgacagtgtggtggcagacgcccgcgcctatgctcgccgg
aagagccgaaggaggcgcattgctaggcgccacagggctactaccgccatgcgagctgca
aaagctattctgcggagggccaaacgtgtggggcgaagagccatgcttagagcggccaga
cgcgcggcttcaggtgccagcagcggcaggtcccgcaggcgcgcggccacggcggcagca
gcggccattgccaacatggcccaaccgcgaagaggcaatgtgtactgggtgcgtgatgcc
actaccggccagcgcgtgcccgtgcgcacccgcccccctcgcacttagaagatactgagc
agtctccgatgttgtgtcccagcggcaagtatgtccaagcgcaaatacaaggaagagatg
ctccaggtcatcgcgcctgaaatctacggtccaccggtgaaggatgaaaaaaagccccgc
aaaatcaagcgggtcaaaaataacaaaaaggaagaagatgacgctgatgggctggtggag
tttgtgcgcgagttcgccccaagacggcgcgtgcagtggcgcgggcgcaaagtgcgtcaa
gtgctcagacccgggaccactgtggtctttacacctggcgagcgttccagcactactttt
aaacggtcctatgatgaggtgtacggggatgacgatattcttgagcaggcggcagaccgc
cttgacgagtttgcttatggcaagcgcactagatccagtcccaaagaggaggcggtgtcc
attcccttggatcatggaaatcccacccccagcctcaaaccagtcaccctgcagcaagtg
ctgcccgtgcctgcgcggagaggcgtaaagcgcgagggtgaggacctatatcccaccatg
cagctaatggtgcccaagcgccagaggctagaagacgtactggagaaaatgaaagtggat
gccgatatccagcctgaggttaaagtaagacctattaaggaagtggcgccaggtttggga
gtacaaaccttcgacatcaagattcccaccgagtccatggaagtgcagaccgaacctgca
aaacccacaaccacctcaattgaggtgcaaacggaaccctggatgcccgcgcccgttgcc
gcccccagcaccactcgaagatcacgacgaaagtacggcccagcaagtctgctaatgccc
aactatgctctgcacccatccatcattcccactccgggttacagaggcactcgctactat
cgaaaccggagcaacacctctcgccgccgcaaaccacctgcaagtcgcactcgccgtcgc
cgccgccgcaacactgccagcaaattgactcccgccgccctggtgcggagagtgtaccgc
gatggtcgcgctgaacctctgacgctgccgcgcgcgcgctaccatccaagcatcaccact
taatgactgttgacgctgcctccttgcagatatggccctcacttgccgccttcgcgtccc
cattactggctaccgaggaagaaactcgcgccgtagaaggatgttggggcgagggatgcg
ccgccacagacgaaggcgcgctatcagcagacgattagatggtggctttttgccagctct
tatacccatcatcgccgcagcgatcggggcgataccaggcatagcttccgtggcggttca
ggcctcgcagcgccactaacattggaaaaacttataaataaaaaatagaatggactctga
cgctcctggtcctgtgactatgtttttgtagagatggaagacatcaatttttcatccctg
gctccgcgacacggcacgaggccgtacatgggcacctggagcgacatcggcacgagccaa
ctgaacgggggcgccttcaattggagcagtatctggagcgggcttaaaaattttggctcg
accgtaaaaacctatgggaacaaagcttggaacagcagcacagggcaggctctgagaaat
aagcttaaggaacaaaacttccaacagaaggtggtcgatgggatcgcctctggtattaac
ggcgtagtggatctggccaaccaggctgtacaaaaacagataaacagccgactggacccg
ccgcccgcaacccctggtgaaatggaagtggaggaagagcttcctccgctggaaaagcgg
ggcgacaagcgtccgcgacccgagctggagcagacgctggtgacgcgcgcagacgagccc
ccttcatacgaggaggcagtaaagctaggaatgcccactactaggcccgtagctcacatg
gctaccggggtgatgaaaccttctcagtcacatcgacccgccaccttggacttgcctcct
ccccctgcttctgcggcgcttgttcccaaacctgtcgctaccagaaagcccaccgccgta
cagcccgtcgccgtagccagaccgcgtcctgggggcacaccgcgcccgaaagcaaactgg
caaagtactctgaacagcatcgtgggtctgggcgtgcagagtgtaaagcgccgtcgctgc
tattaattaaatatggagtagcgcttaacttgcttgtctgtgtgtatgtatcatcaccac
gccgccgcagcagaggagaaaggaagaggtcgcgcgccgaggctgagttgctttcaagat
ggccaccccatcgatgatgccccaatgggcatacatgcacatcgccggacaggatgcttc
ggagtacctgagtccgggtctggtgcagttcgcccgtgcaacagacacctacttcagtat
ggggaacaaatttagaaaccccacagtggcgcccacccacgatgtgaccaccgaccgtag
ccagcgactgatgctgcgcttcgtacccgttgaccgggaagacaatacctactcttacaa
agttcgctacacgctggctgtaggcgacaacagagtgcttgacatggccagcacattctt
tgacattcggggggtgcttgatagaggtcctagctttaagccatattctggcacagctta
caattcactggctcctaagggcgcgcccaatacatctcagtggatagttacagcaggaga
agaaagagcagtaactaccaccacaaacacatttggcattgcttccatgaagggagacaa
tattactaaagaaggtttagaaattgggaaagacattactgcagacaacaagcccattta
tgccgataaaacatatcagccagagcctcaagttggagaagaatcatggactgatactga
tggaacaaatgaaaagtttggaggtagagctcttaaaccagctaccaaaatgaagccatg
ctacgggtcttttgcaagacctacaaatataaaagggggccaagctaaaaacagaaaagt
aaaaccaaccgaaggagatgttgagactgaggagccagatattgatatggaattttttga
tggtagagaagctgctgacgctttttcgcctgaaattgtgctttacacggaaaatgtcaa
tttagaaactccagacagccatgtagtttacaagccaggaacttctgatgataactctca
tgcaaatttgggtcaacaagccatgcctaacagacccaattacattggcttcagggataa
ctttgtaggcctaatgtactacaacagtactggaaatatgggagttttggctggccaagc
atcacaactgaatgcagtggttgacttgcaggacagaaacactgaactgtcatatcagct
tttgcttgattctctgggagacagaaccagatacttcagtatgtggaaccaggctgtgga
cagttatgatcccgatgttcgcattattgaaaatcacggcatcgaggatgaactgcctaa
ttactgttttcctctggatggcataggaccagcgaaaacatatcaaggcattaaatctaa
agacaatggatgggaaaaagatgataatgtttctaaatctaatgaaatagccataggcaa
caaccaggctatggaaattaatatccaagctaacctttggagaagttttctgtactccaa
tgtggctttgtaccttccagatgtttacaagtacacgccaactaacattactctgcccgc
caacaccaacacctatgagtacatgaacgggcgagtggtatccccatctctggttgattc
atacatcaacattggcgccaggtggtctcttgacccaatggacaatgtgaatccattcaa
ccaccaccgcaatgctggtctgcgctaccggtccatgcttctgggcaatggtcgttatgt
gcctttccacatacaagtgcctcaaaaattctttgctgtcaagaacctacttcttctacc
tggctcctacacctatgagtggaacttcagaaaggatgtgaacatggtcctgcaaagttc
ccttggaaatgacctcagaacagatggtgctaccataagtttcaccagcatcaatctgta
tgccaccttcttccccatggctcacaacacagcttccacccttgaagccatgctgcgcaa
cgataccaatgatcagtcattcaacgactacctctctgcagctaacatgctttaccccat
ccctgccaatgcaaccaacattccaatttccatcccatctcgcaactgggcagccttcag
gggctggtccttcactaggctcaaaaccaaggagactccatctcttggatcagggttcga
tccctacttcgtatattctggatctattccctacctggatggcaccttttaccttaacca
cactttcaagaaggtctccatcatgtttgactcctcagtcagctggcctggcaatgacag
gctgttgagcccaaatgagtttgaaatcaagcgcactgtggacggggaagggtacaatgt
ggcccaatgtaacatgaccaaagactggttcctggttcagatgcttgccaactacaacat
tggctaccagggcttttacatccctgagggatacaaggatcgcatgtactcctttttcag
aaacttccagcctatgagcaggcaggtggttgatgaggttaattacactgactacaaagc
cgtcaccttaccataccaacacaacaactctggctttgtagggtatcttgcacctactat
gagacaaggggaaccttacccagccaattatccatacccgctcatcggaactactgccgt
taagagtgtcacccagaaaaagttcctgtgtgacaggaccatgtggcgcattcccttctc
cagcaacttcatgtccatgggggcccttaccgacctgggacagaacatgctctatgccaa
ctcagcccatgcgctggacatgacttttgaggtggatcccatggatgagcccaccctgct
ttatcttcttttcgaagtcttcgacgtggtcagagtgcaccagccacaccgcggcgtcat
cgaggccgtctacctgcgcacaccgttctcggccggcaacgccaccacataagaagcctc
ttgcttcttgcaagcagcagctgcagccatgacatgcgggtccggaaacggctccagcga
gcaagagctcaaagccatcgtccgagacctgggctgcggaccctatttcctgggaacctt
tgacaagcgtttcccggggttcatggcccccgacaagctcgcctgtgccatagtcaacac
tgccggacgcgagacggggggagagcactggctggcttttggttggaacccgcgctccaa
cacctgctacctttttgatccttttgggttctcggatgagcggctcaaacagatttacca
gtttgagtacgaggggctcctgcgccgcagtgcccttgctaccaaaaaccgctgcatcac
cctggagaagtccacccaaagcgtgcagggtccgcgctcagccgcctgtggacttttttg
ctgtatgttccttcatgcctttgtgcactggcccgaccgccccatggacggaaaccccac
catgaagttgctgactggggtgtccaacagcatgctccaatcaccccaagtccagcccac
cctgcgccgcaaccaggaggcgctatatcgcttcctaaacacccactcatcttactttcg
ttctcaccgcgcgcgcatcgaaagggccaccgcgtttgaccgtatgaatatgcaataagt
catgtaaaaccgtgttcaataaacagcactttatttttacatgcactgaggctctggttt
ttgctcattcgtctcatcattcactcagaagtcaaatggattctggcgggagtcatagtg
acccgcgggcagggatacgttgcggaactgtaacctgttctgccacttgaactcgggtat
caccagcttgggaactggaatctcgggaaaggtgtcttgccacaactttctggtcagttg
cagggcgccaagcaggtcaggagcagagatcttgaaatcacagttggggccggcattttg
gacacgggagtttcggtacactgggttgcaacactggaacaccatcaaggctgggtgtct
cacgcttgccagcacggtcgggtcactgatggtagccacatccaagtcttcagcattggc
catcccaaagggggtcatcttacaggtctgcctgcccatcacgggagcacagcctggctt
gtggttgcaatcgcaatgaatggggatcagcatcatcctggcttggtcgggggttatccc
tgggtacacggccttcatgaaggcttcgtactgcttgaaagcttcctgagccttaattcc
ctcggtgtagaacatcccacaggacttgctggaaaattggttagtagcacagttggcatc
attcacacagcagcgggcatcgttgttggccaactggaccacatttctgccccagcggtt
ctgggtgatcttggctctgtctgggttctccttcatagcgcgctgcccgttctcgctcgc
cacatccatctcgataatgtggtccttctggatcatgatagtgccatgcaggcatttcac
cttgccttcgtaatcggtgcatccatgagcccacagagcgcacccggtgcactcccaatt
attgtgggcgatctcagaataagaatgcaccaatccctgcatgaatcttcccatcatcgc
tgtcagggtcttcatgctactaaatgtcagcgggatgccgcggtgctcctcgttcacata
ctggtggcagatacgcttgtactgctcgtgctgctctggcatcagcttgaaagaggttct
caggtcattatccagcctgtacctctccattagcacagccatcacttccatgcccttctc
ccaggcagataccaggggcaagctcaaaggattcctaacagcaatagaagtagctccttt
agatataggatcattattgtcgatcttctcaacactcctcttgccatccttctcaatgat
gcgcaccggggggtagctgaagcccacggccaccaactgaacctgttctctttcttcttc
gctgtcctggctgatgtcttgcagagggacatgcttggtcttcctgggcttcttcttggg
agggattgggggaggactgttgctccgttccggagacagggatgaccgcgaagtttcgct
taccagtaccacctggctctcgatagaagaattggaccccacgcgacggtaggtgttcct
cttcgggggcagaggtggaggtgactgagatgggctgcggtctggccttggaggcggatg
gctggcagagcccattccgcgttcgggggtgtgctcccgttggcggtcgcttgactgatt
tcctccgcggctggccattgtgttctcctaggcagagaaacaacagacatggaaactcag
ccatcactgccaacatcgctgcaagcgccatcacacctcgcccccagcagcgacgaggag
gaaagcttaaccaccccaccacccagtcccgctaccaccacctctaccctcgatgatgag
gaggaggtcgacgcagcccaggagatgcaggcgcaggataatgtgaaagcggaagagatt
gaggcagatgtcgagcaggacccgggctatgtgacaccggcggagcacgaggaggagctg
aaacgttttctagacagagaggatgacgaccgcccagagcatcaagcagatggcgatcac
caggaggctggcatcggggatcatgttgccgactacctcaccgggcttgggggggaggac
gtgctcctcaaacatctagcaaggcagtcgaacatagttaaagacgcactactcgacctc
accgaagtgcccatcagtgtggaagagcttagccgcgcctacgagctgaacctcttttcg
cctcagataccccccaagcggcagccaaacggcacctgcgaggccaaccctcgactgaac
ttctatccggcttttactgtccccgaagtgctggccacctaccacatcttttttaagaac
caaaagattccagtctcctgccgcgccaaccgcacccgcgccgatgcccttctcaacttg
ggtccgggagctcgcttacctgatatagcttccttggaagaggttccaaaaatctttgag
ggtctgggaagtgatgagactcgggccgcaaatgctctgcaacagggagagaatggcatg
gataaacatcacagcgctctagtggaactggagggtgacaatgcccggcttgcagtgctc
aagcgcagtatcgtggtcacccattttgcctaccccgctgttaacctgccacccaaagtc
atgagcgctgtcatggaccatctgctcatcaaacgagcaagtccactttcagaaaaccag
aacatgcaggatccagacgcctcggacgatggcaagccggtagtcagtgacgagcagcta
tctcgctggctgggtaccaactccccccgagatttggaagaaaggcgcaagcttatgatg
gctgtagtgctagtaactgttgagctggagtgtctgcgccgcttttttaccgaccccgag
accctgcgcaaactagaggagaacctgcactacaccttcagacatggcttcgtgcgccag
gcatgcaagatttccaacgtggagctcaccaacctggtttcatacatgggcattttgcat
gagaaccggctagggcagagcgttctgcacaccaccctgaagggggaggcccgccgcgac
tacatccgagactgtgtctacctctacctctgccatacctggcagactggtatgggtgtg
tggcaacagtgtttggaagagcagaacctcaaagaactggacaagctcttgcagagatcc
cttaaagccctgtggacaggttttgacgagcgcaccgtcgcctcggacctggcggacatc
atcttccccgagcgtcttagggttactctgcgaaacggcctgccagacttcatgagccag
agcatgcttaacaactttcgctctttcatcctggaacgctccggtatcctgcctgtcacc
tgttgtgcgctgccctccgactttgtgcctcttacctaccgcgaatgcccaccgccgcta
tggagccactgctacctgttccgcctggccaactacctctcctaccactcggatgtgata
gaggatgtgagcggagacggcctgctggaatgccactgccgatgcaatttatgcacaccc
caccgctccctcgtctgcaacccacagttgctaagcgagacccagatcatcggcaccttc
gagttgcagggtcccaacagtgaaggcgaggggtcttctccgggtcatagtctgaaactg
acaccggggctgtggacctccgcctacctgcgcaagtttcatcccgaggactaccacccc
tatgagatcaggttctatgaggaccagacacatcctcccaaagtcgagctctcagcctgc
gtcattacccagggagcaattctggcccaattgcaagccatccaaaaatcccgccaagaa
tttctgctaaaaaagggaagcggggtctaccttgacccccagaccggtgaggagctcaac
acaagattcccccaggatgtcccatcgccgaggaagcaagaagctgaaggtgcagctgtc
gcccccagaggatatgaaggaacactgggacagtcaggcagaggaggagatggaagattg
ggacagccaggcagaggaggtggacagcctggaggaagacagtttggaggaggaagacga
ggaggcagaggaggtggaagaagcaaccgccgccaaacagttgtcatcggcggcggagac
aagcaagtccccagacagcagcacggctaccatctccgctccgggtcggggagcccagcg
gcggcccaacagtagatgggacgagaccgggcgattcccaaacccaaccaccgcttccaa
gaccggtaagaaggagcgacagggatacaaatcctggcgtggacataaaaacgctatcat
ctcctgcttgcatgaatgcgggggcaacatatcctttacccggcgatacctgctcttcca
ccacggtgtgaacttcccccgcaatatcttgcattactaccgtcacctccacagccccta
ctgcagtcagcaagtcccgacaaccccgacagaaaaagacagcagcgacaacggtgacca
gaaaaccagcagttagaaaatccacaacaagtgcagcaggaggaggactgaggatcacag
cgaacgagccagcgcagaccagagagctgaggaaccggatctttccaaccctctatgcca
tcttccagcagagtcgggggcaagagcaggaactgaaagtaaaaaaccgatctctgcgct
cgctcaccagaagttgtttgtatcacaagagcgaagaccaacttcagcgcactctcgagg
acgccgaggctctcttcaacaagtactgcgcgctgactcttaaagagtagcccttgcccg
cgcttattcgaaaacggcgggaatcacgtcacccttggcacctgtcctttgccctcgtca
tgagtaaagagattcccacgccttacatgtggagctatcagccccaaatggggttggcag
caggcgcctcccaggactactccacccgcatgaattggcttagcgccgggccctcaatga
tatcacgggttaatgatatacgagcttatcgaaaccagttactcctagaacagtcagctc
tcaccaccacaccccgccaacaccttaatccccgaaattggcccgccgccctggtgtatc
aggaaactcccgctcccaccaccgtactacttcctcgagacgcccaggccgaagttcata
tgactaacgcaggtgtacagctggcgggcggttccgccctatgtcgtcaccgacctcaac
agagtataaaacgcctggtgatcagaggccgaggtatccagctcaacgacgagtcggtta
gctcttcgcttggtctgcgaccagacggagtcttccaaatcgccggctgtggaagatctt
ccttcacccctcgtcaggctgtactgactttggagagttcgtcctcgcagccccgctcgg
gcggcatcggaactctccagtttgtggaggagtttactccctctgtctacttcaacccct
tctccggctctcctggccagtacccggacgagttcataccgaacttcgacgcaatcagcg
agtcagtggatggctatgattgatgtctaatggtggcgcggctgagctagctcgactgcg
acacctagaccactgccgccgctttcgctgcttcgcccgggaactcaccgagttcatcta
cttcgaactccccgaggagcaccctcagggtccggcccacggagtgcggattaccatcga
agggggaatagactctcgcctgcatcgaatattctcccagcgacccgtgctgattgagcg
cgaccagggaaatacaaccatctccatctactgcatctgtaaccaccccggattgcatga
aagcctttgctgtcttgtttgtgctgagtttaataaaaactgagttaagaccctcctacg
gactaccgcttcttcaatcaggactttacaacaccaaccagatcttccagaagacccaga
cccttcctcctctgatccaggactctaactctaccttaccagcaccatccactactaacc
ttcccgaaactaacaagcttggatctcatctgcaacaccgcctttcacgaagccttcttt
ctgccaatactaccactcccaaaaccggaggtgagctccgcggtctccctactgacgacc
cctgggtggtagcgggttttgtaacgttaggagtagttgcgggtgggcttgtgttaatcc
tttgctacctatacacaccttgctgtgcatatttagtcatattgcgctgttggtttaaaa
aatgggggccatattagtcgtgcttgctttactttcgcttttgggtctgggctctgctaa
tctcaatcctcttgatcacgatccatgtctagacttcgacccagaaaactgcacacttac
ttttgcacccgacacaagccgtctctgtggagttcttattaagtgcggatgggactgcag
gtccgttgaaattacacataataacaaaacatggaacaataccttatccaccacatggga
gccaggagttcccgagtggtatactgtctctgtccgaggtcctgacggttccatccgcat
tagtaacaacacttttattttttctgaaatgtgcgatctggccatgttcatgagcagaca
gtatgacctatggcctcccagcaaagagaacattgtggcattttctattgcttattgctt
ggtaacatgcattatcactgctatcatttgtgtgtgcatacacttgcttatagttattcg
ccctagacaaagcaataaggaaaaagagaaaatgccttaacctttttactcatacctttt
ctttacagcatggctactgttacagctctaattattgccagcattgtcactgtcgctcac
gggcaaacaattgtccatattaccttaggacataatcacacccttgtagggcccccaatt
acttcagaggttatttggaccaaacttggaagtgttgattattttgatataatttgcaac
aaaactaaaccaatatttgtaatctgtaacagacaaaatctcacgttaattaatgttagc
aaaatttataacggttactattatggttatgacagatccagtagtcaatataaaaattac
ttagttcgcataactcagcccaaatcaacagtgccaactatgacaataattaaaatggct
aataaagcattagaaaattttacatcaccaacaacgcccaatgaaaaaaacattccaaat
tcaatgattgcaattattgcggcggtggcattgggaatggcactaataataatatgcatg
ttcctatatgcttgttgctataaaaagtttcaacataaacaggatccactactaaatttt
aacatttaattttttatacagatgatttccactacaatttttatcattactagccttgcg
gctgtaacttatggccgttcacacctaactgtacctgttggctcaacatgtacactacaa
ggaccccaacaaggctatgtcacttggtggagaatatatgataatggagggttcgctaga
ccatgtgatcagcctggtacaaaattttcatgcaacggaagagacttaaccataattaac
ataacatcaaatgagcaaggcttctattatggaaccaactataaagatagtttagattac
aacattattgtagtgccagccaccacttctgctccccgcaaaaccactttctctagcagc
agtgccaaagcaagcacaattcctaaaacagcttctgctatgttaaagcttcaaaaaatc
gctttaagtaattccacagccgctcccaaaacaattcctaaatcaacaattggcatcatt
actgccgtggtagtgggattaattattatatttttgtgcataatgtactatgcctgctgc
tatagaaaacatgaacaaaaaggtgatgcattactaaattttgacatttaattttttata
gaattatgatattgtttcaatcaaataccactaacactatcaatgtgcagactactttaa
atcatgacatggaaaaccacactacctcctatgcatacataaacattcagcctaaatacg
ctatgcatctaaaaatcaccatactaattgtaattggaattcttatactatctgttattc
tttattttctattctcctatgattagtcgtccccatatagctctgaatgaaatctaagat
cttttttttttctcttacagtatggtgaacaccaatcatgatccctagaaatttcttctt
caccatactcatctgtgctttcaatgtctgtgctactttcacagcagtagccactgcaag
cccagactgtataggaccatttgcttcctatgcactttttgccttcgttacttgcatctg
cgtgtgtagcatagtctgcctggttattaattttttccaactggtagactggatctttgt
acgaattgcctacctacgtcaccatcccgaataccgcaatcaaaatgttgcggcacttct
taggcttatttaaaaccatgcaggctatgctaccagtcattttaattctgctactaccct
gcattgccctagcttccaccgccactcgcgctacacctgaacaacttagaaaatgcaaat
ttcaacaaccatggtcatttcttgattgctaccatgaaaaatctgatttccccacatact
ggatagtgattgttggaataattaacatactttcatgtacatttttctcaatcacaatat
accccacatttaattttgggtggaattctcccaatgcactgggttacccacaagaaccag
atgaacatattccactacaacacatacaacaaccactagcactggtagagtatgaaaatg
agccacaaccttcactgcctcctgccattagttacttcaacctaaccggcggagatgact
gaaatactcaccacctccaattccgccgaggatctgcttgatatggacggccgcgtctca
gaacagcgactcgcccaactacgcatccgccagcagcaggaacgcgtgaccaaagagctc
agagatgtcatccaaattcaccaatgcaaaaaaggcatattttgcttggtaaaacaagcc
aaaatatcctacgagatcaccgctactgaccatcgcctctcttacgaacttggcccccaa
cgacaaaaatttacatgcatggtgggaatcaaccctatagttatcactcagcaaagtgga
gatactaaggggtgcattcactgctcttgtgattccatcgagtgcacctacaccctgcta
aagaccctatgcggcttaagagacctgctacccatgaattaaaaattaataaaaaatcac
ttacttgaaatcagcaataaggtctctgttgaaattttctcccagcagcacctcacttcc
ctcttcccaactctggtattctaaaccccgttcagcggcatactttctccatactttaaa
ggggatgtcaaattttaactcctctcctgtacccacaatcttcatgtctttcttcccaga
tgaccaagagagtccggctcagtgattccttcaaccctgtctacccctatgaagatgaaa
gcacctcccaacacccctttataaacccagggtttatttccccaaatggctttacacaaa
gcccagacggagttcttactttaaaatgtttaaccccactaacaaccacaggcgggtctc
tacagttaaaagtgggagggggtcttacaatagatgacaccgacggttttttgaaagaaa
acataagtgccgccacaccactcgttaagactggtcactctataggtttgtcgctaggac
ccggattaggaacaaatgaaaacaaactttgtgccaaattgggagaaggacttacattca
attccaacaacatttgcattgatgacaatattaacaccctatggacaggagttaacccca
ccacagccaactgtcaaataatggcctccagtgaatctaatgattgcaaattaattctaa
cactagttaaaactggagcccttgtcactgcatttgtttatgttataggagtatctaacg
attttaatatgctaactacacataaaaatataaatttcactgcagagctgttttttgatt
ctactggtaatttactaactagcctttcatccctaaaaactccacttaatcataaatcag
ggcaaaacatggctactggtgcccttactaatgctaaaggtttcatgcccagcacaactg
cctatcctttcaatgttaattccagagaaaaagaaaactacatttacggaacttgttact
acacagctagtgatcacactgcttttcccattgacatatctgtcatgcttaaccaaagag
cattaaataatgagacatcatattgtattcgtgtaacttggtcctggaacacaggagttg
ccccagaagtgcaaacctctgctactaccctagtcacctctccatttaccttttactaca
ttagagaagacgactgacaaaataaagtttaacttgtttatttaaaatcaattcataaaa
ttcgagtagttattttgcctcccccttcccatttaacagaatacaccaatctctccccac
gcacagctttaaacatttggataccattacagatagacatagttttagattccacattcc
aaacagtttcaaagcgagccaatctggggtcagtgatacataaaaatgcatcgggatagt
cttttaaagcgctttcacagtccaactgctgcggatgcgactccggggtctggatcacgg
tcatctggaagaagaacgatgggaatcataatccgaaaacggaatcgggcgattgtgtct
catcaaacccacaagcagccgctgtctgcgtcgctccgtgcgactgctgcttataggatc
gggatccacagtgtcctgaagcatgattttaatagcccttaacattaactttctggtgcg
gtgcgcgcagcaacgcattctgatttcacttagattactacagtaggtacagcacattat
cacaatattgtttaataaaccataattaaaagcgctccagccaaaactcatatcagatat
aatcgcccctgcatgaccatcataccaaattttaatataaattaaatgtcgttccctcaa
aaacacactacccacatacataatctcttttggcatgtgcatattaacaatctgtctgta
ccatggacaacgttggttaatcatgcaacccaatataaccttccgaaaccacactgccaa
caccgctcccccagccatgcattgaagtgaaccctgccgattacaatgacaatgaagaac
ccaattttctcgaccatgaatcacttgagaatgaaaaatatctatagtagcacaacaaag
acataaatgcatgcatcttctcataattcttaactcctcgggatttagaaacatatccca
aggaatgggaaactcttgcagaacagtaaagctggcagaacaaggaagaccacgaacaca
acttacactatgcatagtcatagtatcacaatctggcaacagcgggtggtcttcagtcat
agaagctcgggtttcattttcctcacatcgtggtaactgggctctggtgtaagggtgatg
tctggcgcaagatgtcgagcgcgcgcgcaaccttgtcataatggagttgcttcctgacat
tctcgtattttgtatagcaaaacgcggccctggcacaacacactcttcttcgtcttctat
cctgccgcttagtgtgttccgtctgataattcaagtacagccacactcttaagttggtca
aaagaatgctggcttcagttgtaatcaaaactccatcatatttaattgttctaaggaaat
catccacggtagcatatgcaaatcccaaccaagcaatgcaactggattgcgtttcaagca
gcacaggagagggaagagacggaagaatcatgttaatttttattccaaacgatctcgcag
tacttcaaattgtagatcgcgcagatggcatctatcgcccccactgtgttggtgaaaaag
cacagctaaatcaaaagaaatgcgattttcaaggtgctcaacggtggcttccaacaaagc
ctccacgcgcacatccaaaaacaaaagaataccaaaagaaggagcattttctaactcctc
aaacatcatattacattcttgcaccattcccagataattttcagctttccaaccttgaat
tattcgtgtcagttcttgtggtaaatccaaaccacacattacaaacaggtcccgaagggc
gccctccaccaccattcttaaacacaccctcataatgacaaaatatcttgctcctgtgtc
acctgtagcaaattaagaatggcatcatcaattgatatgcccttggctctaagttcttct
ctaagttctagttgtaaatactctctcatattatcaccaaactgcttagccagaagcccc
ccgggaacaatagcaggggacgctacagtgcagtacaagcgcagacctccccaattggct
ccagcaaaaacaagattagaataagcatactgggaaccaccagtaatatcatcaaagttg
ctggaaatataatcaggcagagtttcttgtaaaaattgaataaaagaaaaattttccaaa
aaaacattcaaaacctctgggatgcaaatgcaataggttaccgcgctgcgctccaacatt
gttagttttgaattagtctgtaaaataaaagaaacaaacgtcatatcatagtagcctgtc
gaacaggtggataaatcagtctttccatcacaagacaagccacagggtctccagctcgac
cctcgtaaaacctgtcatcgtgattaaacaacagcaccgaaagttcctcgcggtggccag
catgaataattcttgatgaagcatataatccagacatgttagcatcagttaaagagaaaa
aacagccaacatagcctctgggtataattatgcttaattttaagtttagcaaagccaccc
ctcgcggatacaaagtaaaaggcacaggagaataaaaaatataattatttctctgctgct
gttcaggcaacatcgcccctggtccctctaaatacacatacaaagcctcatcagccatgg
cttaccagacaaagtatagcgggcgcacaaagcacaagctctaaagaagctctaaagacg
ctctccaagctctccacaatatatacacaagccctaaactgacgtaatgggagtaaagtg
taaaaaatcccgccaagcccaacacacaccccgaaactgcgtcagcagggaaaagtacag
tttcacttccgcaaacccaacacgcgtaacttcctctttctcacggtacgtcacatccga
ttaacttgcaacgtcattttcccacggccgccccgcccatgttagtcattcaccccacag
ccaatcaccacacagcgcgcacttttttaaattacctcatttacatgttggcaccattcc
atctataaggtatattatatagatag