>AF134510|Kadipiro virus segment 3 VP3 gene, complete cds.
gtagaaaatttcaagattgtttaattttaaagcgtttgttagttatgtcttttgtagagg
atgatacgtcttgtgttagagaatttgacagattgttgaaagttttagagtttggttatt
ccgttagtgaagatggaacactacctaaaacttacaataatatgaatgatagaatttatt
attctttaggtgatatgtttcaatctaattataataacacaagatatgtcataccacatg
gtactaatgccttatttcagaaagtaggttattttaaaattggaaccgaaagagcgaaca
ggacggctgtgttgaggagcgcagctgcaagtttcgcaaatatcattggagtagaaccga
acggtataaaagcaattagtttcaaaggaaatggttttagattatatgatggttacatat
actcatgttctaattccccgattaatgattttgttgaccattgctcacgcagatggaagt
acgactttgatgatgaacgtaaaattatgctagagcagttggtgatgaggtataaacgta
attacatgagaatgtttgataagattaatcatataaattcaactgatggtttattcattg
ctaaaattgaaaatgaccacttcacttccatgtttacatcgccgaggcacgttaagctag
ttgataatgacgttatatatagtgggcatttaataagggcgatggctggatctgcttcta
tcgatgacggtcgtcttaaaaatcagttgagcacacagggacttttaatgacgcatgaaa
ggtactttttaataggtgaagctcctggtaatcattattcattatataaaagatttatga
acaaagaaaattgtttactgatagaccccagggatgtccattcaagtgtagtcgatatcg
tcagacatgagaagagattcttcacaagggcagacattatgcgtatagctgaaatagcag
cctcgaatcaacatattaactttctgctccgtatcgatatacgtaatgacaagcctcata
aaggagacggagcttataattctaagtgggaagatatggtacagtatgacaatgaattga
cggctgaactaatcaattcaatgccaatgaatgtaaccatatcagctaagctcaggccaa
gttataatactaataacgttatgcccatcttaacaagaaaattcagagttgtacccttac
cttacttgaagaagagtactgctgaatttcacctatttgtgccacgtcatgatctgctaa
acggaactgaaatagatgatgtaagttatgaaaccttaattaatatgtcttatgaagttt
gtgcacttaaaactttatttggcaaaccatacaatacttatttaatggatatgactttgg
ggttaggtgtgatgaataagtttgttaaaccgatgtctaacagcatagcattatatagtt
attcaaattcaagtaatagtagatataacagtgaggagttcaagtttatacgtgattatc
tgtatacttatccttattcgagtttaattgataaaacattcaaccaagtaacacacggta
gatcgtattctgataacacagttaatatatatgatgagtgttcagatgaggcaccactct
ttatacccatatacagtcttccattaaatgcaaaaatcaattattatgatatgcgtactg
tttgtgtgatggataaggatggcttggctaaaattggctttaagtttagtcaacctgata
accagatgtcaactcaaattgtaaaattagtttcgtttattcttaaagaaatatgtgaga
aacgtaacctatcacataagcacttagatgatgaaataagatcgcaggttctagaaaatt
acttcaaagacaaaagtggtatagattataatatagttggtactacagtaatgattaatg
acagactagtctcagttagcggacatatgcagtacatactcattggttcagttctagggt
taccttatggaatcaaaagatatattatggagatcgaatcaaacatactcaatcccaagg
ctgggtatgagcgaaaatctggtagtcgcgtttggcatggttttcacagccactatttgg
ctgttgacagtgctttattatacttgactactctgatgaatttcaaagtggaacaattcg
atatgatcaaaactagttttaattggattaagatacaactgttggatttggcgagtaagt
atagtaattacctacttgtagatgagcgaagtttaatttcgtagtcattttcgacttaat
gatacaaacgttataaatgcaggcaatcgagactaacgcgcgattcactatgactgggtt
gaataggtgcagggcctggagccccaatcctcggtcagaggtcgcgtgatgcgtttttgg
aattttaaaaatgac