>AF037218|Human herpesvirus 7 strain RK, complete genome.
ccccccgtttcgtatttcaaatcctaaataacccccggggggtaaaaaaagggggggagc
taaccctaaccctagctctaaccctaaccctaaccctagctctaaccctaaccctaaccc
taagtctaaccctgaccctaaccctaagtctaaccctgaccctaaccctaaccctaaccc
tagctctaaccctaaccctagctctaaccctaaccctaaccctaaccctagccctaaccc
taaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaggtc
taaccctaaccctaaccctaagtctaaccctaaccctaagtctaaccctaaccctaaccc
taaccctaaccctaaccctgaccctaaccctagctctaaccctaaccctaaccctaaccc
taaccctaaccctaaccctaaccctaaccctaagtctaaccctaaccctaagtctaaccc
taactctaagtctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccc
taaccctaaccctaagtctaaccctaaccctaaccctaaccctaaccctaaccctaagtc
taaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaggtctaaccc
taaccctaaccctaagtctaaccctaaccctaagtctaaccctaaccctaaccctaaccc
taaccctaaccctgaccctaaccctagctctaaccctaaccctaaccctaaccctaaccc
taaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccc
taaccctaagtctaaccctaaccctaaccctaagtctaaccctaaccctaaccctaaccc
taaccctaaccctaagtctaaccctaaccctaagtctaaccctaaccctaaccctaaccc
taaccctaaccctaaccctaaccctaaccctaaccctaagtctaaccctaaccctaaccc
taaccctaaccctaaccctaaccctaaccctaagtctaaccctaaccctaagtctaaccc
taaccctaagtctaaccctaaccctaaccctaaccctaaccctaaccccaaccctaaccc
taaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaaccc
caaccctaaccctaaccctagctctaagtctaaccccaaccctaaccctaaccctagctc
taagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccc
taaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagtttcaccc
caaccctaaccctaaccctagctctaagtttcaccccaaccctaaccctaaccctagctc
taagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccc
taaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagtctaaccc
caaccctaaccctaaccctagctctaagtttcaccccaaccctaaccctaaccctagctc
taagtctaaccccaaccctaaccctaaccctagctctaagtctaaccccaaccctaaccc
taaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaaccc
caaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctc
taagcctaaccccaaccctaaccctaaccctagctctaagttcaccccaaccctaaccct
aaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagtctaacccc
aaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctct
aagtctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccct
aaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagtttcacccc
aaccctaaccctaaccctagctctaagtttcaccccaaccctaaccctaaccctagctct
aagcctaaccccaaccctaaccctaaccctagctctaagtttcaccccaaccctaaccct
aaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaacccc
aaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctct
aagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccct
agctctaagtttcaccccaaccctaaccctaaccctagctctaagcctaaccccaaccct
aaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaaacct
aaccccagccctaaccctaaccctaaccctagctctaagtctaaccccaaccctaaccct
aaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaacccc
aaccctaaccctaaccctagctctaagtctaaccccaaccctaaccctaaccctagctct
aagtctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccct
aaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagtctaacccc
aaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctct
aagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccct
aaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagtctaacccc
aaccctaaccctaaccctagctctaagtctaaccccaaccctaaccctaaccctagctct
aagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccagccctaaccct
aaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagtttcacccc
aaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctct
aagtctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccct
aaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaacccc
aaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctct
aagtttcaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccct
aaccctagctctaagtttaaccccaaccctaaccctaaccctagctctaagtttcacccc
aaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctct
aagtttaaccccaaccctaaccctaaccctagctctaaacctaaccccagccctaaccct
aaccctaaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagcct
aaccccaaccctaaccctaaccctagctctaagtctaaccccaaccctaaccctaaccct
agctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccagccct
aaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagttt
caccccaaccctaaccctaaccctagctctaagtctaacccaaaccctaaccctaaccct
agctctaagtttcaccccaaccccaaccctaaccctagctctaagtctaacccaaaccct
aaccctaaccctagctctaagtctaaccccaaccctaaccctagctctcagtctaacccc
agccctaaccctaaccctagctctcactgtcaccctaacactagctccaggtcatctgtt
ctagatcctatccatatctgccctgactcctggttccataccgctccgagccccaccctc
cgtcccgccctcctcctgttctccatgccctgccttctcaacccttcctcttccacgccc
acattgcctctgcactccgcgctctcttggctgtgcgccctgcctttccgtgacctactg
ggagcgccgccaaatctgttttgccccgcccctgcgcgcgcgggaactgtcggcgccgcg
ctgctgctagcccgccttccagagctccctccctccgtctgcctcctcacccttgccact
cacccttccatctcttctatcacagactctgtgttacaccacctatgactgctgcaacca
cagaacattttgctctccgcgcggcactcaatcgttactggtggctgcttctgggacgac
acaagctcagtttggtatgcaactacgtcacagctcatcgccaacagttactgccgctgc
cgtggcccgaacaggaatttctccaacttgacccggccccctactccaatctccgcaacc
gtgtcgctcaccatctccatcgcggctggccagcggcacacaacacatgtaagctaccgt
acatctctttcacaaacccaaggctcacatagagacaagcacaagctcgcgcaatgacat
taaaacctcccatcattgtcctttcctgtcgctttgccgataacgtctttgctctatcgc
aggtttcgacccccgtccttacttccccaatgctaaagtcaagctgcttccgctcggctc
catcacccttaccagatcattctccagtgacgagcctcatcctattggtgatgatgtgca
tcacagtcatgaccggggtgactaccatactgttatctgcagctggctcacaggaacctc
cccgatcctagtgctgcttcaaggaccggacggcagcatctattgccacgacgtgtaccg
cggccgattgtatctcgtggcccactctgtatcgttgttcgccaggctaggccttcgcca
ctgcgaacctttatatgcggcacccagatggaagcacgttcctctgcccagcatgtgggt
ggcgagcccgccagcgtccgccaccctcacgcaaacactcgccgtgagtgccacgcacgg
tctggacgcgttatactcgctgctaaaaatccacagaggaactccgtgttcgctaatcca
ccccgtgaacggctacgtcctggacatgatactgacgggccgctcattccaagaagcacc
ctgccaaaacactcgcacgtccgttaaaacaacgccacatgtaatggacgcagtctgcgg
tggccgcgggtcatggctgtccatcggctacctagtaaagatgccgcacattcacctggc
ggtgacccgaacatgtctggtcaccgccatagatgtccgacaaaactttctctggcgcgt
ggcggacgacgcgctgctattcctggtcaccggtagtcttttactactgtcgcggccgac
cgcagacttgacgtcttggtcatgtttacagcaagaacctgtgtggaggaactgtctaga
tacgcgcggagaacaggatgagacagaagaccaagagatgaaacaaagcacaagcaaaaa
gcaaaatgagaataaaaaactcaacacctcaaaaaaacacacccgcgtatcgtcggcaat
tccgacctttcccctgagtctccgagaaacgccgccagaagccaggagcccagccgtcct
cgccgccgccacccagtctcacaaaactcgagcgatctcgacgcataatgccacgacaac
aataagaataccgcgccttcccagttacctgctggaagcgcgtctgttgtccgtgacagc
tatcctgaaagacacaaagaaaaaaaaaacccagcctcaggcgtagcagctgcgacgctc
agcgcggtgtctgaaagctcgccaaggtctcgcgtaaaagaacagatgtgaacttcagat
gtaccaaccaaataatacgggttccgctataaaaagtgcacctctattcccgttcttatc
cccgttctaactcttccttgtatcataccttgcatgttaaccggatcccgtggatcttac
acacatacacacacacacaaacttggtgaggtaaacacagaaatctcactaactcataat
cccctacacgcttaccaccacctaaaaatggttatgaccaaaactggcaatagtctatct
tctttttctttccattcacagccaatgtgcagtactcgtgggtccacaacaacgaaagag
actgtagagacacttcctttaagtagaccttagagacacaccaaatacaaccacaaccaa
aaaaaaaacagaaaacaacacaaagccaatgagtgcagaaatgctccgcgctgttcagct
ccagccaagacgccggggacattcctcatctcccacttcccctccactcgaaggagagcc
cagtcccaagagactccaatcgagcaacagtcaccaagggcgtagaggcagacctaaacc
cagagctaaaacatggagcgaagctttatcccaccggtccttcctcaacatttacgcgtg
gctgtctttgagtcgagggtctccgcgaaaagtgtacggatatgccttcaggcacagagg
agaactcgtagcattgccatggccgcctaactggagcctggaacttcaccacgatcccta
tcgagacgccagagcacaaaccgtttggagtcaccgctggggatggcctgcaacacacgt
gacagctcgcacggtgcgggactgcggtgagtgtaagcagtgtgacacattgttatcgca
attgtcttacccgattaactttttattaatgtattaagcactctttcttcacgtgtgact
gttgtgttttttgttgttatctacatcccggcagccctcgacacgcatatgtacgtgtgc
tgcggacgcggagaaaagttgcagcccgtcggatacgtacgcaacagagccgcgccttca
gacctgaactcgttacgcgtcctcctcatagccagggacggagcaatgtatgtgcatcac
atgagaacggcgcgactgtgccgcctagccagcagtgtgaccgaattcgcgcgacgaggg
ctgcagcgagaatccgaggtttatgaagatgatgtttccttgccagaccgtcgagtaggt
tcggcaacggccattcacctgtttgacgtaattacccaggcagccgatgtccacgaccta
ctcaccgtggccggactgtgtcagactcacaccggcgtcagctgccaactgtggtataca
gaccacgatccccacaccgtcgctggggcggcacgcttcacactgacggtcgcacggcag
cagtatcgattgtggccaaacgcacgacgcaaactgctgcagcacctacatccggaccac
ccacttgggctgtggctgttgtgtgccgtgctcacgtacgatgcaaaagagacgaatcgc
gcagtgccacccgtaacgccaggggccgaaaccgtgtgggtgatagttactggcaggggt
gccattctaggattctggccagagagcgccaaaatgtgcagattggcctcgtctatgaaa
ggactctggaaaaacggagcgcgggcgctaaaaggtcactggacatacgcagcacccggc
cggcatagagcgggagaggcctggcctttgtgtgcacactaccaatctcctagatagaac
aaaattaaaaagattaaaaaaaaaaagaaaaaaagtacaagagtgttatcgcgaaacagc
gtgtcaaaaaaaaaaacaatccacatactctagaacaaactgtacccaaaaataagtccg
tgtgcaaaactgggaaaaaaaaaatcaccttcctcgttgccactagagggagtaccgaaa
gtgtaggcaagaaggccacgctgtaaatgactgtcagcgtttggcgctgaaaacattgct
gttcttgctggctcaagcacaatcacgtgattaagattcctttcgttttcaaagtgtgcc
cgggaggcagacatgccctttctcgtgagacattatgagatttgcctgccagagaaccac
gtgacttggacttactttcgttttctaaacgtgccctctaggcatgaatgctctttagcg
ttagccatgaggctagcgtgatcctgtatagtacataagtttctaagaatatgtttttaa
caataatcatgtcccaaaaagtcgcgagtgactaaaattctctgtaaatgaaggcaaatt
aaacaggatacagacagttgtggcagtggtccgtttcgtctttctgtgttttccttacgc
ggctgacgaggtaaagtgtctcagtccatattgttgtctgtgccaccgtagttagcggtg
gcatactaaaaactccgatagatgcagaacaataacaccgaaaaccacgctgtggaacca
gaccacactttataaacaaaacggccttatcacctggaaaaaaaaactaaaaataaggca
atgatacacctgactttccattggaaacctgccgtaaccctgaccacaaatcccatgcta
aatcccctgaaacactgccaaacgtcgctacaaggtttttccgggatcgagccgcagcaa
gcttaaactgaggtcacacacgactttaattacggcaacgcacagctgtaagctgcagga
aagatactatcgtaagcaaatgtagtcctacaatcaagcgaggttgtagacgttacctac
aatgaactacacctctaagcataacctgtcgggcacagtgagacacgcagccgtaaattc
aaaactcaacccaaaccgaagtctaagtctcaccctaatcgtaacagtaaccctacaact
ctaatcctagtccgtaaccgtaaccccaatcctagcccttagccctaaccctagccctaa
ccctagctctaaccttagctctaactctgaccctaggcctaaccctaagcctaaccctaa
ccgtagctctaagtttaaccctaaccctaaccctaaccatgaccctgaccctaaccctag
ggctgcggccctaaccctagccctaaccctaatcctaatcctaatcctagccctaaccct
agggctgcggccctaaccctagccctaaccctaaccctagccctagggctgcggccctaa
acctaaccctaaccctagagctgcggccctaaccctaaccctagggctgcggccctaacc
ctaaccctagggctgcggcccgaaccctagccctaaccctaaccctagccctagggctgc
ggcccgaaccctagccctaaccctaaccctagccctagggctgcggccctaaccctaacc
ctagccctagggctgcggccctaaacctaaccctagccctagggctgcggccctaaccct
aaccctagggctgcggccctaaccctaaccctagggctgcggccctaaccctaaccctag
ggctgcggcccgaaccctaaccctaaccctaaccctaaccctaacccaaaccctaaccct
agggctgcggccctaaccctaaccctagggctgcggcccgaaccctaaccctaaccctaa
ccctagggctgcggccctaaccctaaccctagggctgcggccctaaccctaaccctaact
ctagggctgcggccctaaccctaaccctaaccctaaccctagggctgcggcccgaaccct
agccctaaccctaaccctgaccctgaccctaaccctaaccctaaccctaaccctaaccct
aaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccccgccccc
actggcagccaatgtcttgtaatgccttcaaggcactttttctgcgagccgcgcgcagca
ctcagtgaaaaacaagtttgtgcacgagaaagacgctgccaaaccgcagctgcagcatga
aggctgagtgcacaattttggctttagtcccataaaggcgcggcttcccgtagagtagaa
aactgcagcgcggcgcacagagcgaaggcagcggctttcagactgtttgccaagcgcagt
ctgcatcttaccaatgatgatcgcaagcaagaaaaatgttctttcttagcatatgcgtgg
ttaatcctgttgtggtcatcactaagttttcaagcttttggcaaggcatgaaaaataaca
ttactattggactgtttatacttatcttcaaatgttcactcacagcagcgaaggggacac
tagaaaacactcccaactagaactacgaggcggaacagcaatggaaacccagacgtgttt
ttacttttattttctgaaatcatttaatagcatacaagtacggcctctccgaatcgaagc
taatctgagagcaaagacaaagagcactgtaaaactgaaggcaaaaaaaccccccgctta
aaaaagaatttcataattccgcagctcttccgaagccccccgaaaacaacacagatcgct
aagggtgtctggactgagctcagtatcccggtaagcctccaaagcagatggacataaact
atattctcgtggtaattgaactaccggaacgtggatgcaagtgacgggtaactgcatggc
ccaagcgtttctatcaggaaagcgatagtttttaaagagtctcctggcgcccatggccaa
aaaaaccctaaaactacaagccaagttaacgacggctcctccgcgaacatccagagcgta
gacagcacccaagcgatccataagaacccgttgctttcgaagaagaccacgaccgaggca
tcttccgacaaactttccgataaccacggcaacgccacgcctaggaatgaacctccaccg
ctctccatggtcctccgggacggaaaattcgaacagcacgcctttaggccacggaagagg
cacaagagccttgtcgaaagcaacagcgaaattcaaaacatcctccaccccgcacatagg
gccgaagaaaaaaccccccgaaacgatggactcgaaaaaagcgtacacagggtcaaatct
gcgcagaccacgcttccagagaccataaggggtgtccgcaactctgtaaatggcgttgtc
cacggaacggttaaatgcataaaattcaccccgatctccaataagcatcaaagcagataa
atcagaatagagcaccagaccgatgacccaaacttccacaaaaggacagcagacaaaatt
tctggttaacttgcagacttcgtcttccgaaatgccaagcatctccgaagaggcaaacct
caactcagcgccggaaggccacacgagaggaagtcgatggtgagcatattgcaaaacaaa
atgagcaacgtctccgaaagatacggtttccgcagcgaagctctgcaaaaacgtggtcca
gtagacctccggaacaggtgattcaactgtattcgattccagattaaacaaaccgttcga
tgcattcgactcaacagccgtttccacaccggaatccaaaagcggagaatctgacatact
agcaacatgcaaatgatcagagaaaaaaaaacaagtgaaatgcacagagacaaatacaat
caaactcatactctaaagcacgaacgctgtttattaattaccatgtcaatttcaaaaccc
accagcaaacaaggcaataaagggagagagtcacaaacttagcaacgaaaaatctgggtt
ccaacatcaggaaacgctgcccgctcatctgctcttgcagccaagaagagaaggtcgcag
tcgccctgtctggcagttttcagataaaagcgcgacgaaaaatgacacaatggtttctgg
caccatttgggctgagccgcgtaaaaagtgtgatgtttatagaagttacgcacaccgaca
aacctaaaaacctgaaaactctctgcgatgaaagtcaagttcccgtcgggatcgttatca
ttaaacccataaatttttcccgagcagtcagcgtaaagggaaattctagctccgtctgaa
aaacatttcagtccgaagctcgcaaagaaacacatatcagctaaaacactttttatctcc
gggtcagaaacaaaatgaaaactgtctttcctgtgatgaaacaggatattctctctcgcc
ggccatcgcaactcaaatttttcaccaagatgcctgtcccgaaatgccaaaatttcagcg
catgttgtgatagcttcaatctctggatctgatacctcaaattgcagacacttacacaaa
acgtatgcgtacagacatcttttgagacctttcctcaaaaaactgtcaatagtgtcaccc
acgcgacatagttgatcaggaaataacgttgtatgtgcataaacgcggccaactttccca
agtaagataaccacatcatcagtctcatactcaagttcgtaaacagtcgtcacagtatgt
tttatgtaaccaagaacagtaagttcttcaggacaacacaccaacgcggcgtactttttg
agcttatcttcctcatatccctccacaccataagtcaaaacaagttcaaacccctctgga
aaaaccaaaggcaccctcaaatgcggattcagaaacaaaaacatttttagactattaaaa
tttgtataaacacgtagaaaatccacgagtttagccttagcagattcaaagattttctct
tttctttttttatcagataaaaacgttttctcaacgttggcaaccttcaaatcctttttc
ccgtcaacatgagcaacatattttcgtataaacgaattttccttttttaaatcttttgcc
acaactctcaaaacacgctcttcaaaattgaagtcagaccccaaatctgccatacttaaa
tcgtacctagcgtattaataatctttgtgcaccggtttcgcaaaagggcagaaagccaac
cgcggaatgcgacgcgactggcgaatggtaaatccgcggtgctgagactctttaaaaagc
cttttcctcaccgaaactctcctttgtcgcatcctgtgttcaaagatcctaacctcaaaa
gaacctccacccctaaccgcatgcggcactacgtttggaaacaaaccactccaaagatgc
gtcccatataaattgcaatcttgacaccgaaaaaaacgcactggattgtccatgtagtgc
agctttaaaggattcgtaaatccttccaaaatatcgtgccttaactcccgagctaagtgt
aaaagaaagcacgaacaagttaaagctaccttcttttgacacaagtgctctaggagagct
ctcactctatgattctgtttactgtaggaagctactagaatagaagccacttcaagaaaa
gcggaacagtgccgaggaatggacatcacattgtgactgctaaagtgactacctaaaact
gctaacttcctacaaacgttttcaactccttcaaaaggtagtatccttatttctaaaaag
actaaagactgcgcgaaaaaacgcgctattttgtccaaatcacgagagatgcgttctctt
actctgcgcgccaggaaaagacataaaatgatattacaataaatctttaaaatgtttctt
tctagatgactattccctaaaatttcatcatgtagaattggcaatgttttcgattccatt
gctttcagtattaactccgcgccgagatctttgtcaatactctctctaacgcgtaaagct
tcatcattagttaaatgtaattgctggagaatcaagtcctgtggactaaagtcctgtata
tcggacaaatgtaggacgcccctttctctccgcttcaaaaaacgagaaaatagcgccttg
cgacattccccgcaactacaaagattagatacaacaaagtgataattcatcacgaatgaa
aaaaaaattttgtcgtctaagaaattttttaataggagattggaaggcgctacgacttca
ccagctatttccttcggatttggaagtaactcaaacaaactcaacaatatatttgaatca
cagcgatttctaagcataaaaaattgtaaaaacaatgaatctaagagctccattaaacga
ttaaagtgagacgaaagagtgtcgcgcttttctccagctacaaaatattccgctattgta
aaatgagccaaagctgtagctttagtcagaactcgataaaacggagaagtgcactcttca
aaccttagactttgaagaaacgcgagaaaaccgtctaaagtcattgttgccttgtccctc
cttttaaatgaaacggagtttttctccactaaaacagcccatagtagactgtcatcgtaa
aattttaagcctcgagtttggaacaaatcttctgaagtgagatgaccgctatccgcaatc
atctcctctgtcagctcattcaagttgacgtctaactcgcatgagttaaatgccgtccat
gacagataaggatgattcggtataacatacgtaatgcgattccttagcggccctttacaa
acatcataatcgattaaatccattacgcaaatccttgtcaaaaatgtttattcatttcca
tcactagcatcgactccaacacaggctaacgtttctacattggcaaagtaacacaagtca
ttctgaatcttgtcaagaccccccagcttataccctacagctcttacatctttttctgga
ctggtctggaaatttccattcccaaaatttccaaaatatttgagaccactgaaaaaaagt
gccattgctccattaatgttttttgtgttacttaaatattcagcttcgatgttcacgatc
gatctctccagcacatctatgaagctcttttccttagcattcactatgaagaaacctggt
gctagattatttgcagcaaccaagtccgtgtgcttcgcaggctgcctttggatgtaaaga
tgatgcaaataaaagctttccatgaagtttgtttcatcatagtttttgtaatacggaatt
tcaaagctcatctttatcacttctaagcagttgaaaataaagtttgaggatgtgccaggg
tttctgacaatatctttaacctgcttcaacatattgaaataaacgatattgttcatacaa
cccttactgcccagtttcatttcacattccatgctagactccaagttctttaattcatct
aagtacacatcataatacattttcagttcagtaaacaaaacactgttaagagtttgaatt
atgaaaagcaaaaacacaatgttactaagaatattcaacagatttcttttgtcctgaccc
atatccacagtaaccgagataggaaacctggaatgttcaatctgcccctcaataaaactt
aaacacaaatctttggctacaaacatagaaagattagaatatttctcagataaatgtgga
aaaataggtaaatcgatcttacccaaagctggaaagaaatgtaatttgacagagccagga
ttctttttcattgtgcctacatttttaaacctgaaaaaattgtatcgacattcttcgcaa
ccacaaaatagtaaaaagtgctcaagtaagtacaactgaaaacgatcaaaaaaatcgcgt
ctgaagaatgattctgttttgttttgcatttctgtcttaaaagattcgctccaaaatgca
cagctaaagccccctaacttctgcttagattctttactcaattccttcaattttccatct
agtttaaaaaataacatagaaaggtactcacataggtagcgacaccagtatccaattcca
ggcttagcacccaaattaaacaatgatgccccagaatagaaccctacagctgcaagttta
gtaatgcactgccatttggggtcaaaatcttccataaattttaaatcgcgcaactgcaaa
agaaatttatcagcccttgtgaaagttgatggatacttgaacatttcgtactcatagtct
atcaacctattccaaataacaccatctgaacataatcttagcccttttattccaaagcgt
ccagcagctgatgcttgaaggccgttgattagtctggattctgtcaccggaacaatgtac
ttcagttccgtgtctccgtttggaatgatgattggatgtagaaactttgtaacactttga
acaagaggattactgatttcagatgagtgcactgcaaacagaatacttggcatgttcttc
aataatctgaaaaagaacatccatggaaccatcagtaagagtattgtgtagagaataccg
aaaagaagaactttgatctttacatacctatcacaccttggatacatatgccgtggtttc
ttccgaagaatcggagactctccatttaacattctgttcaaattttccgcctcactttca
ctcacataaatcaaactgtcatcatgccagttcagggcatatctttctttgtataagagt
tcttcaaaccctcgcctgataaattctctaatagaccttgcaactttgttgatcttgtta
tcacaatacacataaatgtgaaaattgggacctagtaggatgacagctctacaatttggc
tctacctgacatctcgcgcaagttcctatgacaacatactttcttcttagtattttttcg
agaataccagaacctgtgatgtaatggatgtcattcgaagaacagaaagacaaatcaaaa
ttttgaaaagcatcgatacgaattttttgaccacattggcgattgacaaaattctttaag
gctggaatatttttttgtaagagtacgaactcctcaccgctgcatttggtttctccgtac
cacagtctgtctagctcaatatctaattcaatccttgcaaaaggtgggaaatttctcagc
ccgatactgcaaaaatgtgcaggagattccgctatgatgtacaattcatctgtgaccgta
tctaatgcaagcatcttatttgatgagcagtacatcacaaatggatcaaagtccgggtcc
ggttctcggtaatttggatgtgcataaccaacagcgcaaagaaattcgtctgctcctacc
aaattactccaatcataagtgatgacactacgtctacatttgaaatgataaaattcgcca
aaaataagcacatagtttggcggccaagcaagacagcactttataccattgcgaactatc
tccatgccttctccatatgaagacagcagcaactcaacggcaaaatcaaaagacggtaaa
tccggagtcggttcaatgcaaacatcattgcacacaggaacaatttctgcaaaattaact
tgtgattagtacttccgtcactttcagaaaaattaaaaaccataaaaagtactgttactt
acttagataccaggagtactgttgaaccggtgcacttccaagagttgataatcttccaaa
tctggcagtgacttttccaattttatcataaccaaaatctccacaatatctcgcgaagcc
gatccttgcaaaagtcagtaaacaatcagcaatccgcgtcaacactttatcaatccaatc
ataataataaattgctcctgtttctccaatgcatagaattggtctcaaaccatagtcttc
ggctgaaatatttaaaaaacctaaaacaactactttttcaaacagtgcctcttgttcttc
aaatcttttttggtctgaggtgccacagtgtatgtttttcctgtcttgcaggattaacgc
tgtaaagattggagtttccaaacgaagttttaaaccagtgtttatagaaacgaagtgttc
aatctctgctaacgttttacaccttgccaattcatctaattcggagagcattgaaatata
atttctcctcaaagcttttagtgccaaagctgttttcctgttaaatcttagactagaatt
caaattaagtggttcctgtaataatcctaagtctttaagagtctccaatttttcaaactt
tggaccatcataataaaagcgagtataaacaggttctgagcaagtgattacatttgtacc
tagaataccaaatctaacaaatttgtcaaagtcttcagctatgtaatacaaaacatcatc
ctccaaatcgtgacaaaaaattcgactcgattttcccacaaaaattggcacgtctttcct
tccaatttgaatcgctccaatcaagcacaaattttccttaaatccttggtaatggtcatt
cagttctgccaattgttgttctgagtaaccagcaacgtcaactggctgtgcaagccttaa
ccacaaattctttggccaaatcaaagacaagcattcatttcgatgtcgttcagtaagaag
gcgaattccagggaaatcagtaaaacgacataaattcttcaattcccttaacaatccatc
atttagttgtccaacacaaggcaaagttttatattgttctgccatcgtctcaaaattttt
cattgaagtgaatgtggtaagaagtttgtattctcatccatttctcaaaaactcaaccag
ataaatataagagaaaaaaatcacatgacaggaaataaattttaaagctttgcagatttt
ttatttcccattacaggaaacattagagtgattaaaaccataagcctggtgttatcggat
taaaaacctcttgtcgaaagtaggaatcggatttttaccttttttaaagatcgattttta
gaacattcacggtaacaatacaaaactaacagtgtcattaatattacaaactcagaatct
gccactgaaaggaaaatcccttttcgccctaagtaactacacttaaaaatggctatagca
gaaagcggagcgttcgaaataaatgtcaatcttggaaaatccatcgcttccatacaaaaa
aatcctataatctacatgcgtagacatctctctttttatgtggagttattaaaatttatc
attcatcaatatgagcaatgttttttaccaccgaaaggaacgatactttaccacaatggc
ttaatcgaactaaatactttaattatcgatctgaatcaacaaattacatcgaaacagcag
atctatagttggacgagcattactttgccaaaaatattttcgactaaagaattatatttt
attgtcgcgtcaccagaatcggaaaacataactctcaatccagctgttactaaaggagga
tggttatctgggagttttagctttccattgagtttaagttgtgcatacgccctcactggc
gtatcttcaacaatctatatgttaccatttattccatataaattcccaatgacttacgta
gacttttcgacacttcgaacatacgaggtaacaagtgaatatggatcaatccaaattata
aaacagcggaattttttatttttgggaattatacgggatctgtcatggaaaagtcagagg
gataacaagaattttatcctgaaagcaatgttcgttggaaactggttagggatacaaatt
ccagaagcttttgcattgagactttttaataacacacggttttctattcaggattttgaa
ttctccattaacatacaaaatataaaccttactagggacaataaaattttgggttctctt
tccacggtttcttgtgatcagatgccaccaaacttgtctccagagaatctcccaaactat
ctagttattcagttcgaattggtttcaactctcgcaaatcctgatcatctactgttttct
tgcaatcccaaattgtttttcacaggagatattctgaacagcgctataaatttacaacat
agtcctaatcattatgagcttacagtgtacgcaccacataatttacatttctatcccagc
tgttttcatatagtaacattaccaattcagttttcatccagaaatgatagacagatgttg
gtgtcaagctatcctaatgaaggctactttgaagtacaaatgtgcccatgggtacagaat
tctcctcttcaaattgttattaaatctttttcaaaaaatctagtgctaccgcaaggcacc
cctattgcaattctcttatatatggaaaaaatgacaacaggaaaaaattctttacgggat
caagaattaaaaattaataaagacattacccgaataggaaacgtaaaccttccaaaagaa
aatttcttacattataatagctaatctttattcaactgtgttttagacgacgtcttcttc
tgagtgtgttaaatgcgatactagtttattaactatatcatcatctttttgaacagaatt
ttcaagatcgattaaatctttatcgccatcttcttgagccttgctagcaccgaaaatggt
attttgcgtctctttgcctgttaaaagtgaacctgaatcaaaatcctggatttcagcatt
tggtaaaaaaaatggagaccgcacaggctgcatcttttcagtgaagctaaaattttgaaa
taaaggatctctctttctggagttcagtaaattcttcaggttgttgtcattgaaagtcgc
aatgttagaaacatctgtttttttcgggggttcgagtacgtcttttaagcttcgctcttc
taaactaattgtatccgtaaaatccgttaataatttcttaactttttcacctagtcctga
ttcaaaaagttctttttgaagaagatcgttccttctactaagatccagtaatgaagaact
cggagtccacttcacatctttgactaattgattttttttagctgaagaagcactctcttt
ttccttcattgaagcgtttacgtcattagtacctatcatatttaaagtcttggtggaaga
atttgctttatttccatttttttgcttaatgcttttttgatcttgtggaggcaatgacat
ttcattatgctcgtcatcaaaactttgtaagttctcgtggacaatttcttttctgcgttt
ttctgaaggaagtttaaaaatgtcttcattattttgtttaattgttttgattcgttctcg
tagctccaaaattttctgcaagtcattggtcgagtttttagacagttgatcgcgtgattg
cactccgttttgtctgtttacttcgttttctggcagaaaaaaggtagagtgataatcaat
tttatttttgggtagctgaactacgttaacttttggtgagctaacaatgtctattacttt
gtttgagttgtgtagatctagtttgctcaaggtatctataacttggttaataccgtctgg
tgccacagcaatttcattgaattggtttactttgtcctctggtctgtgcatagtttgatc
agttaaatcaagtatttcagtctgtagtattctgtgcatttttttagaattgtttataga
cgtggaatttcttggctcgtccaatatcatggaatccttttttaccgaggataacaaccc
atcttcagagcctacaaataaatctttggatagcgtgttgttactccgttgttcagtttt
tataaatggttctggattaaatgatgaaccatacgaagtttttttagaactactctcaaa
ttgattgcttaaagacgatttcgacaaatctgttaaaactttgaatgtctgaatcggttc
aggagtaaattttacacgatcatcccatgtactctttacgggaagagcatgtaactcaag
actttttgttataacatcaaagtcttcggttaaaattttaaaaaaagaagttactctatg
actagttaatggcaaacttaaaatttgataagaatatatcgaaacaaaatttttgttgtt
ttcaatcgcctttaaaattgcatttttcttttcattaatggtatttaatgcgagtttctc
catgttcatccaggatccatgtaatgtaattaataaattcccaagataaagcaatcgatt
gatgttagtaacatagtagccattttcattccacggatcaactatttggtaaattgtgaa
agaaagcatattgttttttgccttttgtaaattctcgccaatttccgctctttcttctgt
ggtaagattgacgtaatcggctgcgtgtgtcacagtgccccaacgaagaaaactgcccag
tttaagcaaatcttttgctacgtttttaaattctgtttcaaagccaactttgttaaaaga
tgttaaactagaataatcagtaatcatctgtctttgctctaagtaatctttcagaatttt
ttgcacctttagtatttcttgccaaacttcctcatagtctggtttctttttacacaaggt
ttgatgaaaataaatccaaagaatcaaattgttgtaaagtgtttttacattgttaatgga
atttccagttttaacgatacattgactcaaaatccatggattttcgcgaatatcaacaac
tggtaaagacgatatgttttcaaaaaatcgagataaaaaacactttgcttcatccgaaat
ccaagcaaagggtaaatgtgacattttcatgactcgttttttctgttgagcattattgaa
cacttcttaaaaaattagtttaatagtctctattttctctttgattagatacatgcgctg
ccgacatggacactctaattgatttccaaaaaatcctggtatgataatctaatgttatga
tttgctacagctttgctaaaaatgttacctttgcatttttaatcatcttgcaaaactttt
tttcacagcatgatgaagagtacaagtacaattatacgtgtattacgccaacagtacgga
aagcccaaagacttgaaagcgtaattaacggaattatgctaacgctgatacttcctgtta
gtactgttgtcatatgcactctgctaatctactacaaatggacaaaacagacaattactt
ctccatatcttatcacactctttattagtgattctttacattcattgactgtgttacttc
tcacattgaaccgagaagctctcacaaaccttaatcaggctttgtgtcaatgtgtgcttt
ttgtatacagtgcgtcctgcacatacagtctgtgcatgctagcagtaatatccacaatac
gctatcgaaccctgcaaagaaggacattaaacgacaaaaacaataatcatattaaaagga
acgttggaattttatttctgtcttctgccatgtgtgccattccagcagtattatatgttc
aagtggaaaagaaaaaaggcaattatggaaaatgtaatatacacatctcaacgcaaaaag
catatgacttgtttataggaattaaaattgtctattgttttctctggggaatttttccaa
ctgtcattttcagctatttttatgtgatttttggtaagaccttgcgtgccttgacccaaa
gtaaacataacaaaactctgtcattcattagcttactgatactatcctttttatgtattc
aaataccaaatctcctagtaatgtctgtggaaattttttttttgtatatagcaaatactt
cctgcttaggcaccatacaaagagaaattgtgcaaataatatctagattaatgccagaaa
tacactgcttgtctaatccgctagtatatgcattcactagaacagatttccgattacgat
tttacgatttcattaaatgtaatttgtgtaattcatctttaaagagaaagagaaatcctc
tgacaataaaaaattgaacagtgaagcttgcttaaaactttgaaaattttttgtgatttt
aaataaaatttaaaatcaatttatcctaagcttttcaggctatgactttgaatcaacagc
catctaattgcagactaattacagctaacgatccagtacttgcatcgaattttacaatgc
agcctacttttaaaatagccgataagaaagttgtactcagagatcataattacattgcag
tcaaagattttgttctatcaaggtctttcatgcattgcattcgatgtcaggaaaaaattg
aaaagaagacatccgatagcattagagcatattccattaagccagatttcatgttttatg
actcagacgacgaagttcgttcgtcaccatttttataacaatatttaaagtagctgaatt
gtacgttctgaaacagtctgaacggatccgctgaacgcagacacaatggaacagcaaaaa
ggattttcgattccattttttgtcactgacgaaaactgcaactttgtgcctgaaatatta
cctcgtatacatactaaatttcttaaagatgtcttaattgccgattcctacaactctgtt
agttgggcaaacagttttattcccatgcctattcaaacgcttgaacaaattatggttctt
ataacaaagttcaagttttctcgctcgcgtgattttttattcccagtaattcgattagct
gttcatatcaataggttccacacagggaagaaacagctgaaaaccatgatagaaattatg
aaaagcttgtttaacaccgaagaggctatgcgacgattcgatgaagcattgatgattcta
ttttctaatgagcaaaccaatacttacatgacaaacatagctttatcgatgcatgagaat
ggtcttccagattcaaaatttatgaatgctctaaaaatgatttacagagctggaaattct
tttgataatcaaccagacaatgatatagaaagctacaacgagaaattaaaaatctacaac
tacctaattaaaatacctaagtacacactaaaagctggagttgatttatataatgaaaat
ataaaagatctttcgattggaatccaaagacaacctactttattattcacatctcgtaat
gatttttcattgaaagctatttataatgacgtgttatttctagtttctgcatggaatatg
atcatcaactataaaaaagaacaaagaagactctttagttggataacatttgaaataaac
tctttaatggagaatgttgtgcttgcagcctttcagttaccagatttaaaagaaatgaca
cttgatttaagcgctttgattgccaacatgaatcttttaaaaccaaatgatgattacagc
ccccattttaaactaattatcaacaaattttttgaaatcggaatttttgtcacgaaatca
tatatttgtattttgccttcttttgtcaaaagccaactcatttcgtttgaaaacgtttta
agttcaaacagacatgcggaagatgtgactttcatactaacatcttccaaggaatctgat
gatgaatatgatgaagataaacctccacgacaagtagatccagacagagtggacaacatt
ttaatggaatcagatttttttaatgtgaaaccggaaaacgccttttcagaaatcgcatta
atgccaatttcacatgacaaaattatagatgtcaacaactcaaacatacaagttcttgaa
actgaattggcacatacaaatttatttgtgtatagcgcaatagctcaaaaatatgatttg
cctttaaaagaatacgtagagcgcttaaacgtctacaatcctgatctatcatctggaaac
tctacacccgcgcggaattctaattctattcgtacaactccagttctaaatatatccaga
ccaggaagcactacaccctctgggaactctgcaagatatgggaataacacacctagaagt
ataactccggttttagagatttcaagatctagaagtgctaccccttctggaaattctgaa
atctatgagaatagaacatccccaacgttccgtgtttctaggagtgcaactccaatagaa
agaagttcgagatctgctagtataatttctggagaatctgttcctggtttttttaatgac
caagaacgtttgagcaccaattcgcctatttccataaatggtaatactccaagacagcaa
agccatggggacaatgaaatacaaactatagattccacggatgaagactcaatgaatgcc
ccacaatcaccccaatccatctattcaatttctagctatgtttcaacagacgatcaactt
ctacattcaccgacaaatagcccatttaatctttttgactctgtctcggaaatgcaagaa
gacaccgaataattaattgttttttatttagctaattcattgtatgacaacacaagggca
attgtttgattaatttccacgttttttagcttttgaataatctcaattaaaacatctctg
gtcagttggagtcgttctatgtatgaaaaaaacattatcgcgttttcatgctcatcgtct
ccaagcctcagatgactttcttctagaaactaaagaaaaaaaatgttaaaagatctttta
cagaagaacatttattatttttaaaaatgatttttcttaccgcataaatcatgtttaaga
aaagttgcttttcatgctttgttgtcatcatatacaataatgctgtgattttcctgaaaa
taaaagagcggggttagacaataaaattttgaaactcgtttgtgtagaaataatagaggt
ggactcaccgttttacaggtatgtgtgtgaattgagcgacgatataacaatcctcagttt
tgtggacatctagattgaaaatctgcttgatttcttgccatctcttaataataaacaaag
cttcaatcactacagactttgtcacagttgtggttaatgttaatccagaaaaaataaatc
tatatgttgtattaaaatccatttgaaaaagatattttatatagattgtctccactttag
atataatattagataacgtcatcaatatctgtagtggacacagctcgcgaaattcctgta
gtcgttgtcttctccaggtttccatttctcacaaagaagagtctaccctcgtagaagaac
actaactaaatgaatttttttaggcgaacgcttaaaaaactcttttactggcacaccgcc
tataaaaacccccaaaggaaatttttatgtaaccacacagaaccaaaaaaagattaaccg
ttattagaaagtgttcgtttttaacgatttttattggcacattttgaccgggttaaattt
cgtcttcatcagatgtatccacttctctgaaatcctcacttaaatatatagctaatccgg
cagcgtgtgggcaggtcggataaatttcatgagtaattgttaaattccttggaaaaaatt
tgtatgtgcgatatgttctaactatcccctgtcttaataaacattcaaaattttctgcaa
ttttgacacagggaccgatcccggttccaattgcgtcaataccataaataaaacctttta
aatccatcattaaaaataaacttttaggaaacattaagtttttaccgacgctgccaatga
tatgtccatagtatggcatattgtcataaacgtcagctagaaaattccattctgtgcgat
tagggaattcttcttttctggttagaaacaaaactagtttttcatccatcttttccctct
tcaaacgaagagtgtacactttcccactgttagccgctattatttcagcaaacttcacaa
gattatactgtgcatgaatgagactttgcaaaacgtgatcgatagacgttaggaagggaa
tgtcactatcttgataaatcggatcaaaacggtgcaacccgaaataagcaaagcgctctg
ttgattcagcaagcaaatataaattttctttttcgaagtccaaagcatagaaacgctctt
cttctccgagaagaatgatggttttagcagctgctgttgttacgtcgtttttagcactca
gaaaaccgatgacttgtaacctttcattgcaacataggagatagcaacctatgaaaacaa
caaaaacttattagaacatcatgacacattggaaatgttttgactgcttttgcaacttac
ataggtcttgcagctcggtttcactagtagttctgaaaggcatatcccgcaaaggcgaaa
tgattattttcctactctgaggccatcttatgaagatttcacacccactattttgagtaa
cgaagtcactaagagaatcgcgataaaaggcttgtttaacaaggcttaaatttgcgagtg
catgcctaaatcgaactttttgttcactttcggccatgttgaagcacactctaagcttat
gaaaacagcagttgtgactaggtttttatatattactgaagcatgacgtcgctttatgct
taagctggaaagttctgaaaatatacagctatcttaaacaagtctgtttacaatagggat
ttccttttcctgtaaatgctgcctgatactagaaatcatgtccgtgaattccagtatgga
aatctgggaaattccaaaatatatgatatataaattcctacttttccatgcagcatcatt
aacgccgaatcgaatatacacattttcagagctgcagttgacatactaaaatatggctat
taagatcaccgtatgtcttcgatactttaatcgagatcgtaacgaacttggaaacattac
ttttaatatggaatacaaagacaggagagtcgctgtgacatcgagttatattcgggtaca
ttttgtttttaatcagcgttaactgatcaaacttagaaatgtttcctttaatacaaaatg
cggaagaaaaagcttacacttacctcttctttatattgagtaaaaatggaccgcgggggg
aacagattttaacagttctagattacactcggtttaaattttttgatggctcagtgacca
ttgcacactcaaaaaaaaattattttctttcaggttctctcagatataagaaagatgatt
atgacgttattcaaaaacaaaaaggtaagcgaattacatgtaaacattcaaaatttattg
tttgttaaacatgtagaaactcacaatgttttctctatgatccagcaaagacttgcaaag
acagaaattgaaatgagcctgacagtcacgtaaaagtgttcaaaaaagattccggatgat
aatcgagaataaatcaaccaacattcttgtcaactttgcgccgatttactatcgacaaac
agaaaaacaaaaaaagtaccattgctgatccgccgacaagaaacactacaccaatagttg
tcgcttgggtttgatcgaggaagctttcgtaatcattcaagaagatgacatttttacctc
catatgaagcgctgagatcttccaattctttgtacttgtaccaatcaagccacgatgact
tccaagttttgcgcaaaaatcttttataaatagtttcattgcgtactattgtaaagtttg
gatttaagactttcctttgatatatttcatcagataaatgaggacatatcattgctacga
aataacaatcataattaaatttttgatttagaatttcaagtgttttgtttttatcttttc
cgacgcttctccacttaactgcaactatgccagatcttagctgcaaaagaaacttttgac
cccctgtcataatagtgatggaaccacccgaattatgaccttctaaccaacattcaagtg
tactgttagcccgagaagcaaagtgccattttttggcaattagtgctcttaacataactc
ctctaaagtaataattgatcagcactctcaaataggttaatttatgagatgttgtagtaa
gatttactagactcatttcgcgaaatccttcagtttttaaagacaaagaaatcagaaaag
ctgttcttacagataaacaactagaattccctattagcatttcattaacataacacgtgg
tgacacaaacagcttctaatttattatctagaaatattatattctggtgacatttcaaat
ttgacatgagtgtgagagataagcaaatcaaaaagacaaaaaacatcatctcttttccca
tggtcctttataaagacttcacaatttcttcaagaaagtccacggtacttctataaaaca
aaaaaaacacaattaactattgatgaacattgcagcatttttccaatgcattgccataca
taccccgaagaaatttttcctttgaaaagatactctagatgtgaaaattgtgttgaagaa
agaagttccgtcttagtggacatacattcaaacgcaggctcagggagtttttgaatggtt
gatattctgctatcttgttctttccccctttaaatggccataaaaaagaaattatcagtt
aaagacagcgaaaaatttaaaataagtaaaaaacaataaggcacctactcggtaaattgt
tcgaaattcaccgggaaacccgaagttgaagtgtgttccaagtttttcagtggcgagttt
gctatttcttcataggtttccaatgagaagtttgaactctcttctagcatatctaaaggt
gctgtctctgtctcgttagctgtgtttacctctttatagggatacatttccgctgtggtt
tgcggtttgtaacaccgttctttaaaaaaaatgtcattttgtgatgtttgagtactgcga
gtaaaatgtccgagtcccgtttgcgtagatctggacactaaaattgtcacaccaggtgta
tgacacattttgtaaatcttgcaattatttggaagattgtcattttctgagtatcctatg
gacatatacattttttctgcctgtgtctctctatcattcgaaagcttgtgaccaggaaga
actctttgaaatcgcgcaggtagttttccactaatattgattgttttttgtcgtattcga
tgatagtagttgataaatctttcatggcattcatctctcgacatcttctttgacatgcca
tgtgtaattgcattttgacagctaaattccaatttcgtggtccagaaatcttcaaatgtg
ggcgataaatagaacatcacaccatcttcataagcaaacacatgctgagacaaggacagt
aaaaaaactatttgtcttcgcggcgtcccagaagctgacacccattcttcggcaacccca
aacatcaccatctttccctcaaatggataaaatccgatgttaactaaacgtttaagtctc
ctttctggaagaatgtcagtcatatcacaaattcgaatattgatacacattatgtgttga
atggacacgccatccttcattatttcttgaactgttttttcaaaaaactttaaatctttc
gaagctgcaattaatttttctttgcagcgcagcatcgtcgttaagccacattccttagac
ataatcgtctcttcataaaaaatactgaattttaagcgtatatattcaaccccccggata
tgggcgtggaaattaataaaaacacttcaaaaagcaaactttttattgaaactcattaat
gacacatgaaatctaaggtcccgtgaatttgaagatctggagaatccttagacaggcagt
ctgaatctgaaatttccattttttcagttgcacacaaattttccacagatatataatcac
agggatcaatttccatgattactttaacactatcagatctatcaaggtccttacgcttat
taagaacagccataacatgcagccaaatttcaaaaaacatttttttaacagtgattatag
aaaaaataaaggcaagtataggaatgattaaaagtatccaaaaaacttcaaagtaattcc
cgtgtttgtaagttttgtgaaacaaattttgaaaatattcatctgaattattaaattcaa
ggacgttaaaagagtaattacatttttgatgaattaccacacattgataattagcggact
ccgtgttaatagatttaaaaaaaaagtagaattttttcccttttaagatgtccgatgcca
aatattcttctgtcaaatcatcaggaaccagtttattttctagcttccattgaatactca
atcccagtggactataaagctgcgccgaacacgttatgttagatccacgttttgtgatgg
acaccacaggtggccgatatccatcttgaccgaaggtcacatgtgcagaaaaatctgcga
gttgtttaacacaaaactgctgcacataaaatttgagaataagtaataattcaacattag
catacatgttttcgtcaaaaccactgctagaaaaatccaacaggttgacattcagtgtcg
tgtcattatgaacttttaacaaataatgacttttcaaaacggtgtcaatttcacaaatga
attcagcgttaaaattgtggtgataatgaacactgcgattcctatgtgaccagacaaaat
aagagaaaatgctgtttaatgtagattcgtccttgttggtagaaaagacgtaagacaaag
cattaaatttcgttggaaaatctgtgaggaaagacgaaatactagtattgccgacagaca
gattcttataatgtgccagttcatagttatccatcatcaattcatatttctcaagatgtt
ctttattgattattgacattgtcaacttatgtgccacatatttggtaaaatgtacaatga
aaactaaaagacatgtttttttcacaaacattgctgtttgagagattcttttttaggtaa
cggttcttgtccaaacatcaagtttgttagattgattattttctctgatactggttcttt
ttgtatgtgctgtaaaggccacgtcagaactttctgaacaccgtctaaacaggaaactcc
taataaaactaccgctgtaacaaatgcaaggaataatatagcaatcaatgtgtagcaaag
catgtctacgaaaacattactagacgttttttcactatctaatagatccaaatccacatc
aggtaatgttacctgtatttgtgttcctgtgttcttattcgtacaggtacaaacatatgt
ggtcatttctactcttagaaaaattagaccccaaagcacatcactaccatacaaaggagt
aaaagcacccgtagagttgaaaccaactcttttccactcttctccaaacggactttttat
cttttgcagaacttctaaggagccgaaaccgctaacaccccatcctgtatatttacaaac
tgctacctttacaccattctgtctaaatttcgaaaatgaacaatctatgttattagttct
atatcgttgttcatttctttgttcaatcataggattaaagccttgcttaaatgtagcttc
gaatgttttcgcgagtgataggtactttctttgccaaaaaaaaagttgattgaagtcatt
ttcacaagaattgatcagaaagtttttagcgtgtgtcaaagtgtgccaaattcgataagt
gaagggatcatcttcacctaaatagtttttaatcgctacccacgtgctgtttcttttatt
ttgcaagtagaatgtggtttcaagaattctaggagaaattccagtttcattcatacgtct
cagacggataaaacttttaaagggtgaacagataatttgaatatgaatgtaagactcgac
atcaagacagagtttatcatatcgcttcatcagtccttttgtttttttaaagttcttaaa
caaaaaatgatttagtgtagaaaatacttgataacagttgaaagccaaatatttgccaaa
atcggtttcaatttgcgtttcgctgttgccaaaaaagaaagcattgtctgtcattgccgc
gactgcagagtgtctgattttatcgtctgaacattgtttgctcaaagatatgtcgaacaa
tagcaaatcatccactgtagcattcacatcaaaatccacaactgctaagggacagaaatc
cggatagagttctccataaatcacaggaacgcaaaacagcaagatagtccacatgttgaa
ttagaaaagagtgatgagaaagaaagcttttatttcttaatatatatttgacgactgaac
gtcacagttacgcccattttacggtgataaacgttaggggttccgcaaaaatgtgtgcat
tgatctttctgtgatgacacagtggttagcaaagcacatctaacataataagtctgtttt
tctcagtcataggattccacaacaggataagacatttgtgctggtctgattcctaattac
atgagctgtatttacgccagaattttgtttatttcctttaattaccctcaaaaaatgaaa
acattgatgaaacatacttcccagtgaaacgctttcaacggagatcatgcgttgatggta
gataaaacacaacaaggagaactttgcccaaaaaaacatttattaatcccagacaccaat
aaaggcttggttattgtatgcatttttcggtttcttagaatggttgcgtttggggttttt
aattagtaaaactaacaacgctaacgctacaataccaataaaactaactgctgcaattaa
aatcacaaggaacaaaacgaacttttttaaagggctattcaaaagttgaggttttgtcag
ttctggagttgaaattgtcagtgtgaaaaattcagatgcattcccactgttttcatgatt
agtagtactgccactggagaatgtcgaggtctttgtaaaatttaaggatgtagattcgac
attctctttagttgttgcgatagtcgtaggtatactcatagacacagacattaaatcgct
cgtactctctgtatctgatgtgattgacgtggaactaaaatctgaagttcttgacatttc
cagagtgggcgtactagaaacagtactcatgttaacaaaggtaaccatttctaaaaaaaa
taaaattccaaataacattttaaacactgcgcaattagaagaagcctagtttaatattgt
acgtgtgccgactaaattactgtttttaagcaacgcaaaaaagtgctggaatcggtgtaa
aattcagggcttcgtacccccatatcgaacattgaagatgtgtagaataagaatcagaca
taagataaccgatattatgagacatgccagtattataaaagtccctcttcggcgcacatt
tttgatttcagaactagaagttgaatttattgttcttggtgatagattttcctgatgcaa
aaaaacggaatgatcgtggaacatttgcaacattacatcattataagaaggtggcggtgt
ctcatgagtcatcttctagggatatttagagcacctgataaatgataacatattctctgc
tattgaaggacttatataatcatgatatgcaatgcaagccaaaataaacagaacaaacaa
ataataaatccctttccaacaatcttcataggtctctgggaaaaaatggttgtacttata
aaacattatgtgcagaattattttttctaccaacacttttccatagtaatggttgtttaa
atatgttcctttttttccttttacaagtatttccccatggacagttgatctgccgtgaaa
gctcttcttccacatttctaacatcgtttgttctttcaaaccaatacccatgtagtcgac
gattttcattaaatcgtaaacaaccgattttcaaaaattcagttatgttatgtgcgagaa
aaatgatttgttcatcatctacaccaaaaattttcccattcacatcgaatattatcacaa
gttcaaaccacttcccaaaaacgttgtgttttacacaaaaaagaacatctacaatgttgc
aacgaatgacccttttccaacggtgaaggtcttgatcagtataaggtgtcatgggaagtc
tgcaaaatcgtgtgtatgttttataaggactacttttcaatataaaacaaacgtttatat
tttcatccctataaatgatcatatcagagaaagatttgctatgctccacgattttgctac
cagtttcaaagtccacgataaaatcacacaattcgtagatggggtagaaaaacttcaatc
ctactaaaaagaaatcttgtaagtttgatgaaacatagtaaagacttttgtcaaaaaaac
cattgtagacatacaaatgccctctgtcaccttgtaaaagaattggtcctctgcaagttg
attttttaacatgatgtaacacaccaacaacgatcaacgttttttcacaacacaagtaag
tgtttcgaatttcttcgatgtcttcctttgaaatttctgggattgtttctaatgagtgaa
atgtaactcgccattcttctgggaaaggcaatacgaaagatgtaccttccttacttaaga
tgaattcttcgagaagagtaagtttattgacacagcacaaattcgctaagaaatccatgc
ttcagttttaaaattacccaagaaaaaacaaaggcataaatatttcaatttttttttatt
tagcacatttagaagctgcaaattttctttagaaaaaaattacaaagcaagctgaacaat
aaaaaaggttcaacaaatcgcctgtaaaaatatcttttctacccactgtttttgaaattt
gagcaaatagagcgctataacctaagccaagaaagaactcaaacaacaatgaaaagaaac
aatgttctgttattacccctgctaacaaacacagaatactacacagaacaagttgatata
gtttagtgataaacaaattactatgtaagactgccaagaaaaataaatgctggcaacttt
ttcttggtaaatacaattttccaaaccaaaccagcagcgttaaggttaaaaattgcagca
aataaacaataacatcttttatagccatttggtacgggccattcggtttatagatcggtt
tgtatcgctgaagacacatggcaaactgatgagagttaaccagaaacttataactggtta
catatggcgttatcagaaacactgtaacaagcaatctgtaatgaaccaaatctgatattt
ttaacacaatggcaattagggtgccgaaataagatgccattgaatgcgttggaaatatta
gcatgcatctacagactatggctctcaagcggatttcagaaaaaaataaaaacgagcaga
ttaccaaaaaaaattcatcggtcatttgcaacacgagtaatgataaagttataattttga
gatcgttgaaaggacaatagttaaacaaattcacccgacggtaagtcaatagcaaacctc
cgctaaaaaggaatattagcactacttgttcaaacagcgttttctttatcataagatgga
aacagctttctcccggaattacattccctaaaacaaggcccatagaaaaacttatcatta
cattccacatctttgtcttttcgaatttggggtatagtcaaaatgtgcagaatcgtcact
ttcgctgtcctctttctcattaaaaaaatttgttcctgtgccaccatttttagtgggcac
catgtaacttgtaattttgtgttgcgtttcctgtttacaaaaaaaattatttccttcctc
caccttgtgatttttctctcctttttcctctgtttttgcttgacgttcaaattttgggtc
gtctttaacctgctcttgacttaaataagcttctacggtcagaaaaacatttttagcgat
taaaaataatttgtattctttgccagctattgctctaagactacacgaagactttaaaac
tgcacaagtactaaatgcttgctgtagatttttggaagatagtacaagtctcatgcattt
tgcgtcgtgaaacacaactttcccgctatgagcaaattctatttcgtttaagtcggttag
aaattttatacttggcgggttaacttgcacaactatttgtgccaacgtcatttcattttt
attactgcgtttgttctttgtgaccggagcaagccattttaaaatctccgttacagttga
atggtccaagtctattcgaagtgcagattttccgctttctcttacaatttcttgaccatt
gacacaaggaatagatgcttgtgcacaaatatctgatgccgtgactaaaaaccgcgtata
gagatcgctatcatgttgaatatacagtttagtgacatcaggatttgatataatgcccat
aaaactatcaaataatggaacaaagttatttatcgttttagtcgaaaaatgatctgtatc
ggttatatataaacattctgcatgaataatcagctttaaaaccaaatggttttttgcaga
ttgaattatgattgccggttgaggagtaaaagtaactgtagtattttctcgcaaaagctt
tgcaaaagctcttagaggcttattgattgttttccaagttttcatgtgaaaagccatggt
gggaggctctttggaatctcgatgttcgcgatgatctcggtgactatggtgttctctgtt
gctacgatccatgctgcaccaaaaatagatattaacaggaagagttgtatgagaatacta
aaaaatcacagagatattcaaaccattatatactgtgtttttttggcgccaaatttttat
tacatcactgaaatacatgcatagtactcatcaccacaccatcagaaaaaccactcagca
aatcaaatttttttgatggattgacaccgtcacacttttgatttttatacacagcttgat
aaattcctgttttaaacccattttgatacaaacatactaaaatgtccctcatattttctg
tcttatttatgaaaaatacatttgcttgtccatgatctgtaaacggcaacgcaccgacgt
acatatttagcatttcattcacagaatagtcaaaagcattgagaaaaattgtcatttcct
gcatttcttcttcggaaaataaatttttgttgactttggacacatcataatttacagagc
ttaagtactctaaatggtttttaaatctgtttaagaacaggccattgtacactggtatgt
ataatgtctgtaattcagtagaatagacagacagatcactatggaaaacaggattaggat
gcaaaacttttatactagatcgctttaaaatcttatttccctctatgggacaaaaagatt
gtgagcaatttaacaaatcgaactcttttgacatggccgaaccagacacaaaggttagat
ttctaagcccatatttttttatgtcgcttcttaaattcgtccataaaacatttggtaatg
tatattcaacattatcatacaaatcgcagtgcaaaatcccttgtgcatatttggatcttt
gaaaaaaactgcaaggttccgctccttttttgcaacaattcatacttgttctaacactag
aatagtaaatgttctcgcatactattcgatataattggcatccaagttgagaattaaatg
gcagattcattgacattaatgctgaatgtaatccagtaacacagatagccaagcttcttg
cattgactattccatccattaaaaaatccctattttccaaagcataatctataacagcat
tcccaatcaaaactaactcagtcactgtttttctcattttctttaaattgaaaattttat
ctctataatgaaacatatctatgttagtatgggacttttgttcttctgaaacgttttcga
caaaataagaaagatttaaggcaattctgaaagctgtattcaggccatattcaaaaggaa
ttacatccatagaatttccaagacagtaggaagctatttgaggtaacatggagtacttat
gtatatttttcctaaagatgaatcccatctgtcctctgcgtaggcagcgacaaatattat
ccagcaacgtttcagttttgattctggcatgttcagcggtgcgttcacattcaagatatt
tacttgtaaaatcagattcatcatataaccctaaattaattgccagagctttgtggaaaa
ctgaccaataagaattttcagttttcagccgttccataaaaatttctggcagtattagac
aaaacttgacttgaacagttgttggcaaaatttcacagaagtccagccacattaataatg
acaggtgccaaatttcaagataaattgttagaccagttgttttatttgtgtccttctcta
caatttgtaactgagacaatagcaattccataagagactctgcctcgtagtgataacgag
tcagatttacactaacatatgatccatttaacatcgcaggcaagaaaaaaccactgttaa
tgtccaaaaaatcttccagagaaaagttactcacattatgaaagacagtgtcaaaaacac
tctttttttcagacactaaacccaaattactcatacaaggaaaaggtaacatacaaactc
tcttatacaataaaatcaaaatttcttccactagagggcatttgtgactaacaaaacttt
tttgtaaatattcgattttttttatttgactggccaatgtcacactgattcttagaaaaa
tcgttgggatgttttcttcgattccgttaaatgaatttgaaatctcatcgagaaatctcg
atgcagctaatactcctggtgaaaacttcgctctccagacatggatagctgcttgcaaga
ttttttcaagttctactttggagtcacgtacaaattcaatcaattctttttgtaaaatat
tttcactttctaaaataagtgagatggaatcaaattccgaagcagagtttgttttgagat
agaactggcctaacaaacgatcaacgtgcggtgcatcatgcattgctcccagtgctgaaa
ttatggcatcacgtaagcaccacatatctaagcccgaatttaagcgccggagaatttttg
aaatttcatataactgcttataaagaagagttttgtgatggaagcgtgaatagcaaaacc
gttttttgttatattcatcatgacaaagacatttcctcaagagacccatgtttttattta
tggaaactttattgttaggatccataatcacaagaaaatttttctttcacacaattcgac
aaagacgtctttgagtcttataatggttaatgagataccctgtaagtctaaaattcctga
ttttatgttttgggttttacaatgaccaattcgttgaaggcttccaaaatagtttagatt
tccatcaccgttgatcaaatagttcataaacataaatcgttctttggaaaacttgtttct
taataaatctatcaatacttcttcatgtgtcagctcagataaaacaatgtagatcccgta
ttctattttattaaatgcttgcctatagatataacagaggtaaatgtactgaattgcatt
ttgtcttggttcccagtcaggttccaataataaatctttcaatatgaccaatccatatat
attttcctttcttacgtcatatacatgaccttgcattacacaggatattagacaattagt
cccttgagagatataattagttactccaaacaaagacaccttttcttctaagtaagaaca
actatctaacattgtgttgatactgtcaactaatgaagttttatacagattagctaaaga
agtcctcgtgcagaaagacacattgaaggcattcatggctaaaaacaatacactaatcaa
caaaaattttggactctccgcgtctgtttcaagtctgaacataagcattcctaaatggtc
tcgttcaggtcctaaaagttcgcaaggagtaaaacttcgcgaaagcacacactctttggg
aacaccaaaagctagcaaacttctgatcttttttttctcattttcaatgagattatttaa
ggaagtttcatcaattgtctgatgtttccttttttgaagcatttccattgttcgcaagcg
aaatggattgtacaaatttacaatttgagtcaatattgaatttacttaaaacagatgtgt
ccgataatacattcttaactataacagcgaaaattgaaattttttctcttgcggctgaaa
gtatcacagcagataagatattgtcatttgcgaaattattaccaatacacaattatcatt
tcaactttattaaaaatcatatggtgttttatatattaaattatagtactctaggatttg
ccaaaagattttcaatagctgaaacactatgtagagaattaaaaattttccacagaacat
tccaatcaacgtctaaattacaaaacttaaataatgcagaagtcctttatcaatttgaaa
aacttattgaatccattcaagtattcaaggcggaattggcatcgcctattggtaaacttc
tacgtcaagaaacaatgatctatgacaaacccacagaaaaatcagttaaatatgtcatta
ttcagcaaaatttgataaaaattaataacttaattcaagactgtgaatcgataaaaaact
gtagactcatagcggagctgatagatgaattatatcaaaaagtttataggtggtttatgc
aaattttcacatacgacgatattattttccccaatgacaatttcttagatagacttttaa
aaatggatttctgctatacatattacacggcatctaatcagcatttattatcactttttg
aacagacaattgacaatcaaatttttatcgacccttctccatacttcgaaataaatccag
tatattctcccgaattacaatttatgagcacatttagcttaaagatattttcaaaaaata
tttcagcgaaaaacgaagatctatatatttatccacttttaaaaacaaacttttccatac
ttacctttctgagtttagaaaatatttttttccatcatggatttatataccacatcttgc
atagaacaaatatcacaccaactgaagaaaaaaaattaggaaaaataaatggattcttaa
acacggttattcagcaagtcctaattaaaaagaataacttacaaatcactttcccggagt
tgcttgataaaatctatcatttgcatagaataggcttgaatatcgaaacggcacaaattt
ttttacaaatgttaacaacatacaaaccagcgacgacaaataataagttgcagacatttt
tcacgaatttttcaataataattttttcggcatatattttttttctatgtattgagttat
tcagcccaacttttattttccataataaaaaaaaacttatcctcgagaaacaaaaatcca
tcatactaattctcggtgaacagttctctttcatttggaaagaggtaaatgaaattgtag
atttgttatttagtagcacagttacagaaacctatttcaaattttattctaaaggtgccg
atgactacgaaaaagattttctttataaagacttaatggaaaaatggggtgaattgtttt
tcccattaacttattcaatgacaacgccacagaaatataccgacaagcatgtatcaagta
cagttttgaaaaatttatgtgatacagcatatcaaagtaagatggaaacagcgtatgaaa
gtctattaccatatattactcacccagagttcaaattcatttttattacacattacgtca
gaccttctttgtcattaatcacaaacttaacctttgaagaaataaaagataatcgaagat
tactaatactaatattcgcgtgtaaactgctaatgccatcaaattatcttttatcacatt
acttattattgttacacgctttcacactacaaattttcaaagtagatcttggccattttt
caattatacatgcaattactcaaaaaatttttgacaatattaattctctgacccaaacta
tttttattccaaaaacaaattttttagtcagccttttattaacagcatacactgtgcata
tgcaaacttatgtgaatccttggatacaaaaaacaatcagtgaaaatatagcccttctta
aagaatacatcgatttcacaaagaaatgttcaagtactttggcaactacgtgctatttga
acttagaaaattttgcagtaaatatgtattttgggaaaaacaaggttggaagtacttcac
tatcagctttttatagaacttgctctaagctaattgaggaatctaaactgtttaaagata
ggcttcaagaaatcaaagtttcaaaaacattgtttatagagatgctgcaaaatgttgtga
aaaacatcacaaaatttaaggatttagtctcaaatcaaactttgcaaaattttataatta
ttgttgaaagaatctcctctcatgcaaatacaacatatcaagatgttctcaatagcatag
atgaatgccatttttcaaacatgcaacttatccaatcttttaaaaacatcgtgtatgtca
ttgatgttctgaatactaaaaacatctttaacttttctctcgcatcacaattaattgaag
cgaaaaaacttgtaaaaaaacaggacacctataatcaattaaatgtgcaagatgattttg
tcactgtattaaagtcacatctaaataatctgtttgaaaagcagaagcctacaattaata
ttgaaagaagatttatgttagaaggaatacccgacataaaacagattccattcttggatg
tttttgatgaaagatatagactaataccacaaattgaaaagtatctgcattggtacattg
catatagtgaagctgcgcaggctgatttggtcgagcctttactcttaaaacttggttaga
tgagaatcatagcaggaagtacaaatcaaaacgatcctaaatacggaccaagagccggaa
agcaatgtatgtcaaattgtttttctttcttgcatacagtttatttgaacggaataaaca
atgtgttaaataaagagtctattgacataatcatggaaaatggagcattattggataata
tcagtacaacgacattgaaactcgaaactggcaatatcccagaatatcgatttttcacag
aaatcccaaaaaaaattagttctaattttggcgaaacaatacatgaattatctagaccct
ttaatggtaccttagaatcacaacatatagataatgaagtttatcttggactgttagact
ttctattgtatgggaaaaataagaaaccagcttttattgtcatcactataggggtaatgg
cacgagctatatttatagttgatgaattgttttacctttttgattcacatgcatcagaca
cagaaaactctgcagccatctatatctgtgaggatattgacgaattatatgctctattgg
ccatagagaatgttgcggaattttactatgatgcagttttttcatatttcattgaaacga
ctgatttatctcttgaagacggagatgcaacaattttgattttaaagacttacaaagatc
cagatatagctcttagtttgaatgattttttatcaatgtattcatctacatcctcaacaa
agacagcggaaacaaacactttaatttcaaaacaatcaccaagcaaacgcaaacaagaaa
aaaccagtctaaattcaaattctctagaaaaaaaaaggaagcagggctcatcactcaaat
actataacaatgaagtagatttagtaccaagtttttatgagcttagacctcaatttaaca
atattttatttgagctttctaatttcccaattgtaaaggaaaatgtaaattggacccttt
acatacagaaatttgcaacaaagtctacacagccatttacaaaaccttttatatggaata
gggtattccatctattttctcaagtggttgacgccttaattatgattaaaaacgatcatt
gggatgagacacaacagcaaaaacaattcttcacacatttcttgccgttcaaagaatttt
ctgaggaatttgaaaacgctctagaggcttgccgagaaaataatcttgatctaatattgc
tttataaaaactatctttcgaaaactactgcattcaaaaaccttgaaagaattttattaa
cgaagtttagcgccattgtcagtccggtgcatgaaaaacactacacgcttgtaaacacat
ggctaactaacttaatacaaaaactagtcaaacatcccgaggataccaatgctttcatca
atgactacgtgttaaaaaaccccttaaatcatttcatttgtttgaataagaaggaaaagc
agagcatcgctctactactgaataaaaaaagaatgagtatgctaaaagatgtggaaatcg
aaaagaatggttttgttcaactccaagcattcatcgagaacataggagaagctccagcaa
attatttagatccggaaaatgcacgcaaagtgaatgttgaagaagtctcagaaaaagaca
tcccaacattatccacagataaagtttccatacccaatgaaagtatgttcacatcaaata
aaaaacacagcatagaaaagttaatacatgctaagctgaaagccattttgagtacaatgg
ggcaaagattaactagaattattcaagaaaattataataacatcgctgcaggttttctgc
cggtgaacgatcttaataatctgtttgcctatttggtcaaactctattttgatgtctata
gcatcaccattaacggatttgtggtggaaaacgaattgataaaaaatattgaacaaattt
acgacaatacgcaatatctgagatttggattgacacgcttcaatatgcaaaatttgacac
cgtttactatatctgtccgcaaaatgttcctggatttttttctatcacaaaaaactctga
tagatagagctgaagaaattatagagaaccttgagtttaaatcagttacaccagaaggaa
aacaaaaacttgccacaaagaatatgctcagagaacaattagaacagttgaatgctatgg
atgtggatgatacaataaatctgaaaacagacacattaacacatcaagtattattttcag
accaagaattacgcatgatacaagacttcattttacaactctccattcacaatattccaa
gcattaactttgtgaaatctttgaaattacatattattttagaaaaaagacctgatatac
tattagctctacaagaaaaagtccagaatattctatatttttattttcaagatctagtta
acgagatacctgctcaagaaaatgttttgtcaacaatgttatttataatagagctttttc
cagccgacagtagaatacatctactagaaaccggatatatttccagacatattgtaaaaa
aatggctaaacatgaaatcattgcaagatgctgaggatttaattcgatttataaatatta
ataaagaacaactaggaaaatttgaacatcagccatttggaaaagaaattcaaaaactaa
ttgaaaaaatacacttgttctataagcaaaaagtaatcgagtatcaggaagatgtctgga
gtgaaatggctaaaaatataattttaacttcaccctctgaattatctcaatttttagctt
cagctcccactcaacgtatcatacaaaaacacaaaaataatttagatcagaaacttttaa
tacatatggaaaaccaagccaagcaagcaatggaagatgacaaaaaaagagttgcctgtt
ctaaaattaatctggaacgacacctgaatgatttactgctcttattgaaagacagacaat
ttgcttccatacaggcttctgttttgattgtgtgcgaaaatatatttaaaacgataccag
atgataacctaattattcaattttcacatgctctgctttcagttttacttgacattgaaa
aggatttaaaaagctattcatcagaaatattagagaaaatactaataaataggcccctcg
aaaccagtagattattagtgtttaaagacgcttatggtaatctgaaagagtttttaaacg
ccttaaaacaatcactttttgccacagcggatgttcaaaacaaggctgattttcttatcc
aaattttagattttacctataaatttagacataagacaaataaaggtaaacttctacatt
ccatttataatgaggatttcaaactatacgaagaaacattaacagagttaagaaaaaaag
caacagatgcaaaagagtcgttaactaaactttttaaagcatccgaacaaaagatcgagc
tgtcgcgtacgattccgttaaaggaaatctacctgaacatagaaactgttaatttccaag
gttatggcaacgtagtttttcgagaaagtgcttttaaacgcgcaatagaggtagaaataa
aaaattacgaaatgaaattaaacgatctaataaaacactttaattcacacttaaaaacaa
aaattgaccacatgcagattcttaatctatcttttgataacaaatggaaagattttgtct
ccaagtcaaaaatatctttcccaccagaactgacaataagttcacaagagttgatcaagg
atcccattaaagttataactgaaactctaaacaaagcctcaaacgatttagcgtatgtga
ttagtgaaaaaatattgaagtggttaatagtttttgtcaaagaactgaataccttttttg
tagctacaatgtcagaatttggagaagttatcccctttgactataaacatttcagagctt
tggaatacgaaattaattctaagtacatagagattgaaaataaaataatctgcaacgaaa
ttatcgaaaatactgacaatatagaaaaactctcaaccttgataaaacaaatagatccaa
atcgtattgctggtggtaaacagaaatttcaggattatctgagcaaaattctaacagctg
aaacgaaccagcaacaaacacgctataaagaacagttaaaaaaacagtactttgaccttt
tagataacatcgcccatttccggttcgcattcgattttaaccatcaacaaaatttaattt
taaaactgaaagacaaattcaaaactcttagaacagacactgtatttgaaagatttccaa
atttagatgatacttttgtcagttcaatgaatgtcgagaactttttgcaggcacttgagg
ctttaagccatttcgtgcaggcagcacaaaattttctacaaaacgttttaacagagcaag
cggatttatttccacagacgaatttcattcctgtcgaactttccaccgtcaaaacaattc
caaaatcagatataaatttacgtatgaaaatacacacaccccaaactttttttcaggttg
attcagtttttaatacacagttgatagttgatgagaaaggaattccagtccaattttaca
atgttttccacaatattgttttcaagttttttgctctaaattataagaaaattatcgtac
ctgataaagtgctgaacttagtatcaaccaagtataagatcttaaccacattaaaaagca
ttctgagtgttgtaaaaagcttttggaaagagattataaatttcgatttaacttcttatt
tccaagggaaagcagaatttacttttcaaaatgttttcccaataattaatcttaaaatat
ttatttacattattactcaggcctggtcagtcacatctgatgaaacacagcattcgtttg
aactgccactagaaaaattttctcttttaattatagcaaataatccagagtttctttttg
gttctctgcagtgtccagtggacctagctattaattctctaatacccttattggaaaaga
aaaaatatttcactgcatttaccatctctgacaatccacccaagctatctatggatgaat
taaaaattgtgtgtttggatttgaacacctggagtgaaataacattagaaaaatacactt
ttaaaaagaacagtttgatgcagttatgtatgggcaaagagaaattttttatttaccttt
tatcagcgttggttcttcctcaaaattttttgaattacatttggattcaatacaaacctt
cgtgctgtgctcaggattcattccaacaactcattcaagatttatgtttcgagtatacac
accagaatcacataaagcccatttcattaaatctccaagaaccaaatgcattaaaacatg
gtgaaagaatcctttcgaaattcgtgctggaaaaaaatgcaaacacttctctttttagta
tctttttaggcaagcagtttttattagattatctattattttcatacttaaccgcaactg
aaatgactttttcatattatgtggattccatcaaaaattttcttcttacgatccgacatt
tggaaaatgtccagcaaaacgtagactttagaacgatattgcaatctcgaaatttcgatc
taaaatatcttttaacacaatcatggacacaaaatgttttagaacagtccatctttcacg
tgcaacttgataaaatcattgctgacatcaaacaaccacaactaagtctgaagaaaattc
cactggttttgtttaacggtgacaacgaagtcgtgtcaacttatgtgccccctgaacaag
caagccagacagagcagagctttcgcattaagaatattttcccaaatcctgtgcaagagt
atagtagcaaaaatgtgattctttttacgaactatccaaaaaacaccaaatttttattta
actctcctccacctaaaacagcggcaaaaagttacaaactaccagacactaccgatgaca
taaacacggaaacattatcaagtcccacgattcaaagaatccctatcaaaggacttgtac
ccaaagaaaacgaaattgtctttttaccagaaaaaaacactgcacacacagactctaaag
agacaaaaacgcatttaatagacaccttcaatatattgtctcaaacaaagggtgaaatca
aaacattttctacagattttgatcaaacaatttccaaattaaaacatttgtacttttaag
atgattcgctaactttgctatttaatctatgcaaagcaagcatgcgtaaaaaatcaagtc
tgaaggctgctttttcaatgtttccggtattttgttttgcatattttgctagaaacgtcc
ctgtgacagggtgtgaacccatagaagaatgcaagcctagaatattcgtaaacatttgtt
gctttttcttttcttcttctttttttgaactgttgccagaaatctggttgatttgagcag
tgatttcatcaccacgtgtcgcagccatgttgcgtgcacttagctaattgagaaatttta
cagcctgtacaaatttctccacagtcctctagatcaagacacgtttctctgtagatattt
tgacaatcttggcattgaaattctgtggagtgagaaattagtttcaacagtttatttatc
gttagattctgcagatggatcatagagtaacaagttctgcaagaacatgcaacaatggca
tcaaatttaacactatcgtttaaaatagtgcaagcggaattagttccaattatagctttc
catgatacactttttacttgaatgcctgaaacactatattcatacaattcatatactttt
tcaagtgtcaaacgttgcccgccacataatgaacaataaagcaaatctgtgtgcatactg
taaataatatttttttcctgtctatctcgataataaaacatcgagcttaaagaaaaagtt
tgtttccctttaagcctctctttgccggaatttaaacaatgtccacatttagaacatatc
acagtgagataactatcaattttagcatatctgagacactttgttttgcaaaaacataat
accggtaaagagatgatacttgaagttaagcttcttttcaagactgtcgtcaaagcaaaa
gttagaatttttggaagttgatgtttttcttgtttgttcaaaacaatcggcaccaagtta
ttattttctagcgggattaaaaaacgatcgaaactgtaacaataattttctatcatggcc
atggccatagcaaagataaaatttccacatggaactgttaaagaacacccatgaaatata
tcttgatatgtcaggttgcttgctctatgagcgtatcgcagtgtgatgtcattacattgt
tcaaagttacgtaaacaaaagagtttcatacaaggaatattacaatgagttgaaattggc
aacattaactgttgctgaaataaataataatagagatcattaaaagacacaaacgacggt
atttccaacaactgatttaacttatgtattgggtattgtttgaatctctccacaatttgt
ttccaagtaagacgttgaattttgtaaagagccagaatttttagaaccttgcattgcctg
tacaaaaaatacaaatatgccaaaagcaaaaagaaattttttgtcatcatcattttatta
aaaatagctttaatctgatttcttgaatccagatcacactttaaccaaacttttaaaaac
ttccggtagaaattatcagttaaatctttactcaaaaactttttattcgttacgaacatc
gataatacgcaattttcagatttgctgacatctccaataagaaataactgcaaatgactg
tacgaaccatgtttacacagcggagaaatcagccgacaaagcaaattccttaaagatgac
atagcatacaattagtaaggcggcaaccaaaaaaccacaaagaatattatttctccgtgc
aaaaataggaacagtaactgggaatactgctgcgtcttttgtgtttcccatgtaatttat
actcctgaatgatgtcatctctcctactgacttcaactgtaacctcaatggtttttttat
gtgccttgcagctctatgtttctctaaatcttggcgctctaaaaattttttctttaagat
tatcgctttaagaagagcgatatactcagattcactctcgggaccaaaagccacaaattc
aactataaaagccgcatctcggtttcgtctaataatgcactttgtcagtacaccacttga
agaaggtttaatagcttcaatgtcattcaaacacacagataaacactcattgacatttaa
gatgttgcattctttgacaatgttctgactttcttgttttatgggagcgtggagataaca
agacatggaaacagcacctcccgtatttttaaaaataaatctcgcttcttgttttgtcaa
atcttcccagagactcagcaaatattccaggctatatgcaaaatccaattttaaaagtat
atcacataaaggaaatttaggatttttagaaaataaatttttatctgtgacacgaaagtc
tgcgggacccaattttaaaacgcggcacgtggaaagaattaattcatcgtacatcttttc
tttcaacatgtttattttctctttaaaaatttctgcagttgtatattatgtatttaaata
ttcctgatgttctaaaattccattcacatttaacagtttcgataaaattgaagtgagtag
tttgattttttttttgataatctccgagtgactgcattgatttgctctgtgatgtaaata
ttttaaataggttaagtgtctgtatccaacattaataaaatgtagtcgggcatctaatga
aggcagcattatatcgtacagttttggtaacatagggagaaaagctatttcaatttcaac
tcgggaagataattgttcataaagaatttctatatctgttttggcattgtcgttagacat
ggcttataagggatggaactccgattccttttctatgaactcagaactttttaatgaaat
tcttttatatgcacacttagattcaagtggaatagattctgatgatcttaacacaaatcc
caatacacttgaaaatgaaattaactccgttgaaaaaactttaaatattgaagaactgaa
aaaaattacaactgctttaaatattgacaaccgatgcaatatatgttcaattataaacat
ctgtttacgacatgaaaccgataaaatgtggatctatgactatgctcttttgtgttacaa
atgtaatgctgcacctagaactcccttggctgtcgtaataatcgccaccgaatttatgca
gttgattcaaaagcatttcttaaacataaatttcgatgggttatttttaaacaacatttt
gtcaatactcgattttcatgtacactttttcataaacaggtgtttctcaaacaccaacga
tgatctattacataatgaaaacataaccttatatcacatggccatattaaaatcacttct
attggaagacgaatctataccaaatataagaataaagaaatttaaattaaaaggaaaacc
aacgaaaaaacagcatggaaatgctatccttgaaaaacaaactcttccacttaacacgca
ttttacacatttaattttttatatgtgggctgggacaaacatattcgatcgcatttcact
aactgatctagccatcaagaaacgccaaattttaaaagccatttactctactaaaaatga
gctcaattgttctgcgggaccaatcctactatctcaaataccgatctccatcactaagaa
cgccaccagtagcgtatgcttattatgtgaactaatgacatcttctcagaaaaatttcga
cttgctacagttcatctacaccagtgtcattaattactgtcaaaataatttgaagatgat
tgacagaattcaattcgtactcgcaaatcttttagatttagctagaatatatactaacgt
taaaaccacatcagattgctcaaaaattgtattagccaatgaacaagaattttcaaactc
tgattttgtaattgattgtcatagttttttaattctaaagcaggttggacctgtgggatt
atacaaacatttcttttgtgatccactgtgcatagcaaacattaagacaataaaacccca
tattttattctatacaacagaaagctgtatactacaagacttcaaagttgcaatttgtta
tcagaatgagtatttaaacagtgttgaaaaacatgtttggttagccattcatttttttaa
agcatttcaggtttcaaaattaaaccacaaaaataaaacgcttatatctgatttcttaaa
ggatttcacacagctcttagcagatcaaaactttgaaattgtcgatcctacatttaccat
tcattattacgtttagcatgattattcaaagtacacgtagactgagacgagcatctagct
tgttaaagaaaagcaaaccttacaacaaagaaaaaactaacttatctttatctttgtcac
ttaaagaactccattcggttttcaaattatttccagagtatgaattgaaatttctaaata
tgatgaaacttccaataaccggtaaagaacctatcaaaattccattcgatctaagtctac
atcatcaacatacgtgcttagacttatcaccatatgccaatgaacaagtttcaaaaagtg
catgtgttaattgtggtacaacaaacattccaacagcttcagatgctatggtggcatata
tgaatcaaatttcaaacgtaatgcaaaatagattatattactacggttttcagaaaaagg
ttgaactgattcgtatgtcagccaagcaaccaacgctttttcaaattttttatattcttt
caagcatagcaagtaattttttaccaatcatgtttgaaaataacgagaaattaaatatgt
atgttgttttccaaacaagaactcttcatatcccttgcgaatgtatcaatcagattatga
cagtctcctccggatacactgtacttttagacatcttacacgacagcattgtactacatg
ttctttgtaaaactattgagactagcaatattcaaattgatattaatgttcttcagcgaa
aaattgaggaaatggacgtacccgatgaaataggtgacaagttcgaaaagctgaaacaca
ttctaccgtttatttaaaacagatcacagaacatctgtcaggtcacaaaagctttgatct
acatatacttttaaaggtaggattgaaagtaaaaacttttctttcttaatgcccgttttc
ggaaatattggagagatagcatttgttacagctttcattatttgttcaaaatatttatct
gcattgatttttaagttgttctcaatagcatatgctggatcttctgctaactcataatta
tgaaatgttttttttacggtttctgtgggtgcaattaaaatgtacataactctatctcct
atgtttggcaactcttcctttctttgagctaaccttttaacaacagccaaatgtggtaaa
tttgcttgcttgtaggcagaaatgtcttttgataagactgaagacaaaaccaaactttta
atgttaaccctgtttaagaaaagtgcgtctcgtgcgtcacacaactttttaattattttt
tggataccatcgggaactccattttcatagatttcttgtattgtcatattagagagcttt
tcagcagacttttgtacatcgacatcccaaaagagaagatcgatgatgtctttaactacc
actttaacaaaatcgcaagaagtcttgcgaactaactccacacctttaaaaacaagcgtt
gcatcatctaactttccaatgtaacgtttcttgcatattaaaattaatggaaataggatc
ttttcaaattctaatttgataggatgtttaaataacgtgtttgttatgtggcttgcaata
gaaggagctattcttttcaaagctttgggacaaacatttttgaaagtaacaaaaagactg
tcagtatcaccataaatcacctctattccaaatgtccctgaaaaatcaccgcgtgtcaat
ccaaatttctcaatgaaaaaagtgtccgaatacatggcgctgtcaacgtaatcaacagtt
ttacaaagcatttcacgcccaagacatgtgacagaagctgctattgccacacatggaagt
aagctatgtgttgccccggtgactccgtagactgaattacaagtagtttttaatgcaagc
tgcttcttatctaaaagcatttccatcacggggttgttacacattttcatctgcattttt
acttcttttcttttatccagccattttttcaataaactcgctaaaattgattccctgact
gtctttttaacaaacctgtgcgttacaggtccaacatgcacagtgagaatgtcatctgca
tgtaaaccaattactgcattttcatcaacaaccagggtactataacacagattatgagcc
atcataatacttggatacaaactttggaaatcaaaaactactgttggagtagcataataa
cctattttcggttctaaaactgtagcacctttatagcccacattttctttgcctttatta
aagttagtgttcatacttggtaaaatcatatttaaatttttagcttcgtgtaaaatgcat
gggaaaatttttttttgttgtccctcaaatacggcgcaacgaatagtaatataagcgaga
cttgcaacctcagccatttcatagtgataattaatctttgtaaaaagctgaacaaccaat
agagaatcttgtatacaatatctgccaaccacagctctacctttggaaccatcaataaat
tttttaggaatttccttgtaagagagattttttttttcctgatttaaacaaagtttggct
atagtgtctaatttataattctgagctgagattttagatgaatacacattatacatgtcg
aagcataaaatcccagacatgttaactttagttaaagaattcaaaaacttcttatgctgt
tcgtagggaacgatgacagaaaactttccacgttttagtttcgaaaaaccccctatctca
aaattatatattttttccattctcgtacataaatactttaaatcgaaatttatgatgttg
tatccagtaaggatttctggtgatttacattttaaaaaaaggaaaaaagcatatagaagt
tcaaattctgatgcaaactcatagatgaataccccttcgatttgctcgcaagtgcccaaa
gtaaacaaatgtttactttggtaatttccttcagaatcaaaatcgatgaccgaaatttga
atgatgatgtcacccatttgctcagcatctggaaagtttccattttggcttagacattca
atatcaaaagaacaacaatcatataatggccaagaatcttcctttaacaaaaataaatct
gacacatgacaatttaattcaatttcaacattactgctttttgcaaattcttgaatagat
agataattaatttggtaccaaccaaagctttttaagttgttatcaatgaagaaacgattg
agaatctcaacttctgcttcataaacagaaacgccctcatttagtaaaatttttccaatt
cgattactgatataaaagtttgaaaatgataatttaaataaatttttgataggttccgtg
ttataaccgtagaaattgtatttagttacagattcaatagaaaatgagcatgacattttt
atttcagaactattcagaagtgaacagattctagaattcagctcttttttacattgatat
tcacagtagaaataactattttgtccaaatacattgatacaaacttttttaccacattct
gtttttccaaaaagttttatgacattaccagatggaataacgaaatgtctatattggaaa
gggatgttttctatagaatcagtaaataataaagattcggatgcatcatagatatgaaat
tttaaaggcgcacgcaattctttttcggctacttgagaaagcgatggccatgtcatatca
tttttgagaatgtattgcttatcttgatagaacattctcggttccgagtcacaaagagtc
ttcattaagccgggtgctccatcgtgcattataccgcgcggaaaaatccggagaaaagta
gattttgtttttttcttagttcgtacattctctagatacggattaaagaaggacaccaga
tccatcacagttcttctgttgaaagtttctgatagcccctgtattgaatcctttcaagta
ggcttggtctctgtgatttttttgcctcagcgatttccgcttttttatatgactcatcta
ataatttaatagctttcaacatttttaaagcttccacttgtgaatattcattagtgtgtg
ttatgtcatcaccttgcggttctgtgtctttgttagtttttaaataaggcggagatgaat
ctaaaggttctttcacttgcgcttgaactgattgcgttgcttgaagtaccgaatttgttg
attttgatgtataaggaaataaaatatcaatcggtgtttgtgctaatcgtttatgtctta
aaaataagaaaataactaagccaatcactcccaaagttagtaagatagttagtgctccac
caaatggatttttaagaaaagagaaaactccattcaccacatctcccaaagcaccagccg
ttacacccagcacagcccccaaaccaagaccaagagcgccaagacctttgaaaaatgtgt
caatccctcctatatatgttggagtaacagttgcaatttttgtttctatatggtgtagcg
cacttttgtaagaattgtattctctaagaatggtttccaaatcaaaaacgttcgctttgc
tcagttcatcttttgtatacaattccaataatgtaaaatctgcattttctaaaggatcta
tgtttaagtcaacaaacgcatctaaagcttctatttctgttatcaaactagaattaacgt
acgtatagtctttaaaaatatgagcgaatttaccagacaaaaaaattttcgtgttagatt
gttcacattcttctgttctgtgatttcccagtaatatctcattgtctaaaccaagttgtc
ctaaataagtttccttcgaagaatttgcaaatgaatatgttaacaatggccgagaataac
atcttagagcatcgtaacttgaatcttttgtcaatctcatacttttatgtagctgaacag
aagtctggttgacttcaatgcactttgagactgctaatacatcaccaattaatttagcgg
acatgggtttaccgtacactgctgaaatgattccagaaggacttattttactaagctcgt
gcaacactgtgatagtgcgtttttgatctaaacaccaggcttcagcaagcttacctagtg
ctgtgttaatgtaatctttcagagtgtcgtataggtattgtagttgaacatatacgatgt
ctttgttagtctctaattccctcttcctcctttttctagaagcattagaaaaattttcca
aaaccgttaatttccgttgtattaacggttgccaaatcagaattaaatctccctcagttt
taaaaatttcataactaccatttttgtcatgcgaattgttgtattgcgtttggtaaatct
catccaaaattgaagtataattgctgttaatacaattatattttgaatcagaaagcgtat
aattactttttcctgtgacaaaagaagcagttagttcctgcgcaataaagtgaaaactgt
tagcattttctgcccgtaaagcgtgtgggattgtcatccaatgctttaacaaacaaatgg
aagactcttcattctgcacttcccatgaaaaaatagtatttcccttttccagaaaagcca
ttttagttaacgtcacaaaatttccttttgatccatcatcaaacgttttcagcatagtat
aattatttctaaacaaaattttttccgttggttcattaaatgttttagaattaataccat
tataaaacggtgacccttccacggtttcccctgttgataaagcaaaaaaatcaaaaggat
atttagtctttgcaatgcagtctgtaactatgcaatttatcgatgtagatgttgaataga
accagaggggaccatttcttaaaaatggttctttagtagttatatatcttctgacagtat
cagatttaaaatttaacggaatcaaatccaacgttttattcacatattcatctttatgat
atgcaacatactcctcttcctccgaacgttttacagagatagaggacaaacaacgcgcct
cggtgtttaccatgtgcacttcttcaattggcattggcaaagttgtaacagttcgatcta
agaaatacacagtgccaacatcgcgatatgttgtttgaaatgtaagttcttttttaaaag
ttctgacagaaaacgtgtgtgcttcaatctttgttttgtaaattatcaaaataccttcgg
tagttttaatgttagagccgtaagacgcgcaagaaacctccctgtcaaaacgcactaaat
ctgtcccggtggcaattgaacaaattcgaaatggtaaatgctgattgtgtccagtcatga
caaagtcagcttctgtttgtagagatagctgtaagctaaaagttataaaaacactcagga
atagaattttcattttgtctacatagatctaacagatttggagccggtatatgggaaact
tgcttagtttgtgaaatttgaacaggatcgcattgagtctttaaatcgaaatacaataaa
gagtacaaatcattaaattttgtcgtgttcgttccacgcttgaatagtaaaggagaacca
ctatcaaaagttaaaagtattttttcgacagtttctgtctcttcgccaaacttgacgatt
gataattgttttccaaatacatcattatatagtgcaacagacaaaactaattccctgata
aaattccacatttgtctttgcatatcgttgatattatgcaaaccatcaaaattgaaaaat
ttattatatgtacacagcatccaattttccgggtagatcgtgccttcaacacatttagcc
agatcttctttcatatgtggtaaaaaatctgcaacatcgcaagcatacgccatggatatg
ttgctggacaatggaaaagaagcggtgtgataattcgacaatggaccagtcaacaatcga
tacatttcttgacttaaattaggtaaaagttcctgaggcaatttttttgaaagtagattg
tttttaatgtataagtgatcatcataagtaaatggatcagcagagaaatttcctagtgac
tgcagttgtctatttgcaaatgcgttcatcattttcgaaagactttcgaaaatgtgattt
cctaggatattaatattcattaacttatttattaatgcttcttgctctttgatacacagc
attactttactataacccgattcggaaattttttggtaataagctttttttctaatgtga
atctcttgttgtaaattgtgatcttgtgtcattgaatgcgttacgtatttttttgggaca
gtttcatgagctgaattttcaagttcatttaataaagtttttattttagtttgtatttca
tcttcctctgccagctttgtaaaaaccggatcttcttctaagttttttatactaacattg
gtaataatatcaacgagtctgcaaggggaaataaatctcgatccgatgtataatttgtca
tcatttgtaacattttcttcgttaaaattgaaaacatcttgaatagtttcaccatataaa
aacttactaatttcattttggagatcagcataaagtgaatgacaaagatttagttgattt
agagttattgaagctttttgaataacagattctgaaattttagaccaataggtgaattca
ctcaacgaataaattgtatctggaattttgctaaaaaggtcaaagttgattaaagtgttt
tcagcttcttgtaaatgtggaggttttgaatatagttgctgttgaaaaatatttgtgatt
ttcgccatatactcttttacaagaccatattgttttgtggaaaaatccaaatctttctca
atgatgtcaacgtttttttctaaattggataccatatgtgtttcagttagatgattacaa
aatttgccagctagtcttttacgaatagactttccttgattgggcactaaagataattct
tcataacattttaaacatgtagtagtttcagaaaaaacttctggcttcatcactacgcaa
acgccacacaaaattgttagaaattcaataatttgactgcaagcattaatgccatccagt
ggtgaaattaagccaaaaatacaattcatcttacataaaagtttttcaatatcattgatc
gtagaaatgtctacagaaaaagtcaaataattattaagagccaagtccaattttaagtgt
tgcttgcattcattgagttggaatatattttcaaaatatttttgtttgtcattatctaat
agaaattgatgaattgaagcatcgagtaataagacttgattatacatagcttttaataaa
atctgtaaataaatggttacaggagatgcacaattaaaattttgatgacagagttcagca
aataatgtcttaaacaaatgaattattacaacaccgtttttcctgaaatttgtcatatct
ggaataagtgtgacagggtcacaaaatcgtaagcactctaattctaaagcacattcactt
aaccttgaacacaagacacacaatgattgcaaagaattcatttttacaatctagcttttt
ttaaggagggttcctcattttcatgctcagtctcttcacattttaatataccaaaacctt
gctcattaccttctaccaaaagttctgaaaaatcatagatggcagcactatcttctactt
gttcttcaaaaactgacaataaagttgaaagagaaaaatcatgtacatttaaatccgtta
aatgctgaatcttgttcattacggattttgctagaggctctctaccatccacgtagaata
acatatcatccatagtaggcttactatctctatctttcatcacttcagctaatatgagta
gttctggatttacagaattggataaactttcaataatgttgagcacctttcctcgaatta
cttccacatcataaacaatggcttctctcttaactttcttcacaataatgtcacacagtt
ttgtagcaatcacaaatttctgacgcataaaacggaaatcttgcaagccggaggaaggag
ggtttaaattgcgatctacaccacttccagctatccaacctaactgaccaaagtggaaat
aatctctactagcaacactcacaaatttttcgatcattaaaccaaaggtaataatagatc
ttcctgtgaaaatgctcccaaaatttggttcttttgttaatgatgcagtcataggttctt
taagtccattccctaccaacttttttacgtgcatgacgtattcctgcacagaagaaaatg
ttggatgttctttaagaaaaactgggaataacatagggttttgaggaactagtttagaag
ttaatgcatgcaaacttgttagataatctctataaccaagaactgataataatttattat
gaaagtaatactcgataaaggatagtaagcattctggttgaatatctaacaaatcaattt
catcatatgaattggtgacacgaaaagtaaacttgatgaaagaacgcatgtcttcaacat
tacctatatctatggtttttggcatgttattaagcaaaatacgctgccaaaattctaggc
aggatatttttaaatttggaaagagccgttcatgatatttaaacagcaaaaatgataagc
aaccagaaagtgggttctttttctgtttgacctttttgaaaaaaggattattttgtgtgt
ttttgtttggcttattgaatggtctattttttactcgaaaatctttcaaacattgcatgg
aaaggcgacagagtttagcttggatagaggttttagcatatttacccgatttaaacaaat
tgaaatcaatgtattgttccatgtctacatttgaagctatttttacagttttcatattca
aaaaaccttttttaaaatgactgttgtaaaatgctccgtagagagattggtattgttgca
ttaaccatttagaaattaagtttccagtacaaggcctatctacaacatagcccgtaccga
ttattaaagccaagttctgtaaaacaattagtataactttgtaatacgtgaaaacaaaga
atggagaaaaagccaaagacagaggtgtcgtatcaatgttgaaagattgtagacagtttt
cgatttgttctctggatgtctgcgtttttctcatttctgaaatacattttgaaactgctt
cctcaatgcattgaattaaatcattaatcatattcacaaaatcattttgacttttaaaat
ttaaattgtcttccccagttattgcatcaatcaaattatttttcttacaataatcgtgaa
tcattcctaagaatttgaatctatctaaggaaggtgtggtttgagcttctttcattggat
ctttgctttcattaactccctttttcccaaaagaacctagaacatctacatctgcataaa
aacgagaaaacattgtcataacaataggttcttttttagtcgttttagaaatctgaggta
atctgctgttgattctgatcaatgctgttccgatacacgaatggcaacacttaccttcac
aaaactcacagagattagaggaacaatttacgatgtggttatatatttcagaatttccac
agttcgtgttataaatagacattctgttcaaattccatattatatgcgataagatttgtg
gacatgtcgcacatgcgtaagctagatgaaaagcggaaaatttatcttctttacaaggtg
aagaattacactttatcaattttctggcatcgttataaaaatcttcgttaagagatgaca
aggaattacaaaactggattgaacgcagtaatgtttcttgagtgatcgcagagttaaaag
cttgttttgtgttagatatataggccaatttgttactgtaaagtatcgaattcgcagcaa
agactaaagcagctacatggctagatagatggagcctcaattttttcagttccacgattt
tctcttcgtgggtttcagccgatttgatgatgggccactctgaaaaattcatgatttgat
tattttcataaatagaatcaagatactctgctgtgtaactgaaggttagttccgtgatta
cagcgtccactaacattaaatgatctttttcaatcggtgatagtttttgaccaggaatac
cgtgatatgttttattcggtgcaagcttgacagtttgttcagtatcttggataaattgtt
tcagaccggctttaatcaattccagggtattattaaatcgcaaagtcattccccatgatg
taaagattaagtagaacaatacttcgctgatctgaggcgcataaaagccgttttcttgaa
tgaattcagtgcaagtatcgatgcacaaagtttcttccgattcaaacaaggtagccgaat
ataacggaatttttattgccaagcattcaccaacctggacttgaatctgctcttctacac
atgggattaataatccagcaaataaaagttctttgaaaccattcccaacaactatatgac
atagaacgtcatctgcatttcttccaacactttcacagatctttcctatatccacaggct
ttcgatttccgttaacgacaaattcttgtagattgaatttttctcttgtttgtttgcaca
atttatcaagatttccatggtcttctgcttcttttaaaaaaacatctgtaccgtggaaaa
agaagcatacaggcataaacgatgtgattttggtaatgactgttccgccgtaattaataa
tgggtgttttaacggttgggaagaagtcattttcaaccgttagattaagtaacaagggtg
agatcactactgattttcttttttccattaacgataatgtagtcagaatttctattaatt
tttgttctttcggcagaatgtacagccatgctgcggtacatattggggccgaaacaacag
tttcattatcatcagccattcttgaaacatgaagaccccagtttctgcaaggggtgtttc
tgctaaaccttatatattttagttgacgtaacaaaacttagcgtcatcatacaacggaaa
ttaagttttctcgttctactgttttagtgcggagaactaaaaacgatatactgactcgga
tttgatagtttatgcaaattagcgtccacctcactcgtaatagtatttatttttcatggt
ttttaaaatagaattgcaggcaaggaggatcaatgaaccctcccacttccgcaaagtaag
caacgaccaatcagaagtttgcattgcaagtatttaatttgttgcagcaaagcattagct
agaggacaggcacagagatgctacatattgggaaattaatccgaatcatcagaatcagtg
tcattaatgtcggtctcacaagtttctacatcttcataatctaaatccagttccatttca
ttatcagagttttcctctccattgttttctttaattttcgctgatttcatagaagtatca
ttttcaataaatacaaagcgagtttcatcttcctgtagagtcgtgtttgtttcaaaatct
atagaatcaacttctttactccagtcttttttcagtctgttttcgcgtagctcatttgtt
ttctgtcctttattcgttttatccgcagtaagaagctttttacatttggcttgctttttg
gtttgtaaattcaattggacggtttgcttagattgctgtgaagcaaagctgcaagacgga
gttgtagaacatgcaacattaaagctgttgtactcttcaggcatgttaggatgcagacca
aactccacaaattctttgggaagataggtacagaaatataagcttggtttccaaggtgac
atcatgcgttggattctagtttgacaaccgatgtcatcacattgatgattgttaaattgg
tctccgactaatctggaaatcatgccacattgatattgttcacttacacgatcttggtca
aaatcgcgtatgaactgaggttgtttagtttgaagaatacgttcctttatttgacgtaaa
atccttgcaaaagttactataaatgataaagcttgctgtgctggatattgaaaagatcca
ggagtctgttgctgtacttcatattccgtgttaggcatatcacggtcatataccggtttt
ccacaaagttgtctgaaaatacggtattctatgtcaccatgtccattgtcattaaaaaca
caacaaagttttgccatattcaacttgttgaagtattcaaacttcattatggtaatagta
tacataaacagatcttgagggtcaataggtaagttgtgcacaaaatgatatttatagtaa
atgcaagcttcctcaataatcgcaagagaaaatgctaacgatggagaattcgtcaatgaa
aaaactcggtctccgagtatctgttgatgttgttctctattgagggagtttaagcagttc
ttatatcgtagtaacaagtctgttgtcattagttcttctttttccaaatagattttttca
tgattccggggaaatcgatctcgaatcctatgagctggatctcgtgcttcaccggaatac
ttgcgtaaaccaagggcttccgcggtgtagctagagccaaaaggtgctgttggtaaattg
gcgaaaaaagtcaatgcatgcgtctgtgcacgcttttcttcctgcttttcttcaatgatg
agtttcagctgttctagttctctgagactcaaagcgtctaattttgattcatcaagctgc
ttaataggaatgatgcgtctgtgaaattgtttcgtaaagcggctgacatacttgttagca
ggtttatgaacaagagttcgtttaatggttttcaaaccatatcgttgccgccctaataca
ttctttttaaccccgcgtggatacatgtttctgtcgaaaatgagaaccttgttcataaac
ggccttttatattatttttgtctcgtgtagcggtgacgcctctgtggtttttaatataag
gaacatttgacatataaagctagacacgaattaaggtgcgtctaaaattttatttacaaa
acacaaataaataacataaaaatgtcacatattcaaagaatctaaaacgacagatgaatg
cacttgcttactattagatttacatttcgtagtaaaacatttgctccataatattatcaa
aatgcgattgttatctaccttaaattctaagtacactaagacattttcacggtttccctt
atgattccttgttaaacaactgaaatcacttagttttccgttttgcaatttttttagttg
tatatttttgtgatcaatttttagaaaagttacatgttgaaattgtgtagctgttcgtgc
ttcacagtgttggatgttcttttttaacatttgtggccaggcaattgaacgagtaaaagt
cattaacaaatcatcacgggaaagacaacttgtttccgaaaaaccattgacatgtaaata
tttcaaacataaagtctccagtgaactttgttttctgtgatacagttgcttagtcctaga
atctataaaagaaaactctgttggacaggccttatcaaaaatgctgtagattatctctgt
aatggtttggtctttagttccatgatgtaaaatattattgagatctagttgcatgctaac
gaaatcttgaaaattctttttcattttttccgggacaataaaaataggcttcagacgacc
atacaaaaatctgttattctcttcgtcaactttatacatgaaacctaaccgtaaacaacg
tcccgtattatagattcctgtatcaaaacattcaccaggaaaaattaccgagttaagaat
ctgcattaaatcgtggtttagacacattaaatgattgaatattttagaaagttgttttaa
tggctcacttccaattattgcagtaccttgagggattggaatagcaattcgaagaccaat
tttttttttgcaaacacaaaaagctgtttcaacttcattgtaacatacattgtggttcag
gggattctccggattactacaggtagttttgaaaaaaaagatggggtaggcgtctttgtc
aataaacggaaatattttttgccatgcattgatcagcacattccgcatcaatttacacat
agagaaaaataacgattccgttattatagctgaatcctgtaatggcagatctaaatcacc
aatataatttgtaaccggaaggtattcattaaagatttcatgcctggttacgtaaaactg
tttttctatttcgtcgcttaaaaaggtcgtgtcctgcaaccaaaatgtacttgttaaaga
ttcatccgaaatgtactcattgggtaaaaattgcataacctggtcgaaacccatattttt
gtaccaactttctgcacttccaaaacaataaagatttttgtaagacatttgaactctaaa
cataggaatggggttgctgaattggtcatgtagatattgtctccttgtaacaggtttacc
atctatcaaaatagatttattagatgccaaaatttttaaaaatccttgtaagcctaattt
aattggtgtaaaatacccttcaccgtgtttattgcatttgttaaccatctttgaaatttg
gtctgaatttattacaagcatgatatttctattactgtttatgtcataaacgtactgttg
catttgaaatttgttgtttaacatcctttttatttctacataattttgaaaataactgtc
ttcgttaaagtactgtttcatgattgaaatgagatccgagtgtaaagaatttcctaggat
gtacatattttcctgacattgagaagtatcagatctggtaggatcataagatgtcagttg
actatacttgatgaatttatttttttctaatgctgtactgtaagcaatgtagatatagtg
gactcgaaaactgtttgtgagatgcacgctgtttctaaaaatatctatttgcttatcaag
ataaagaaattcttttcgatctcttatgtttttttgttttgcatattcagaaaaactaac
aaattttttccgatagttagatttcaaagtaatattaatgaattcagacatggaggaata
agtaaataccatatctcctaatttatcagtgaaacactgaacataattcttagttgttgc
tatggtgcttttctgctcttcaaataaataataatacatcgttaatagtagcattccttc
tgtttgaccgtatgttgataaaaaccaaaacggtgacgtgggtaagagatacttatttgt
tagatgtttaatgattatagtcttgcaaaaaaagactaagcttttaaattctatattttc
acttccttctggaacatgagaaagtaaaaaatctttatacagattttctgtttcttccgt
atttaaacagtgaataatatcctcagacttaatgggtaatgcattttttacataatagct
gaaattcaaagattctgcgtcgcaaacaaataccgtctcaattcttttggaaaacttgca
tttctgtgtctgcatacaaaaatatacattttttgatggtttatatttaacgattattgg
aaaaattaaatgttcactagggttcttacataagatatttactatcacgtgcgcggggtc
atattccgttgcaaacacagtaatagtcattgtgaatgtctttcagtttatcttccaaca
gcttttaatataagacaataggaatcatgggaaattgctttgtaaaaaaaatctcttctg
acatcttcaactctaactaccagatgctctattctgagctctcagagcaagaggatttac
tggattttttagagacaaaatatacagattttggaattttaaaaaccgatattctcaact
atgaaagagactccgaaacattcaaaactttgttgcaagtgttacctatctataaaaaaa
caaagctgaggtataatttgattgaacgctgtttaaataattgtccccctcacgttaaag
atgcattgattattgaaatcatgaaagctaagaaaattttagagactctggatgttgtgt
tcatgaaaattatgattggagaatttacaatttgcagtgacaatgtgaatcaattgctca
ataaattttcaatagaccaaacaacattatgtgacatggaaaaaataaatactttaattg
acttagacgaagaaaatagcaagcgtcttttgacagagatcgatcctttgttacatcaag
aaacaggcctgtatcaagcgctgcctaatgcagttacggatccaccaagcgaacagagag
ccgcaactaaaaaatgttacgaaggatttaccaaataaaattttattccgtgctgtactg
aaaccaaagcatcgatgttttatctaacactgcaagctgattcaacactcgattaggtaa
tagctttaaaataaaatgaccgcatgtgaaaatgatggttgcaatacaaattcctgcttg
cacaaagatcctctgagaagtgggattaaaaatctttacacttggagttgtgttctttaa
ccagatattagtttcaaccactaatccatgacagagaatttctttgtttgctattattaa
agctttcaattcatcaggacaatcaaacatgtaatcaaaattttggattgtgtaattatt
ggattctacatagaaatctttattggtaattagtgaaaacttgataaaatttggagaagg
aaaattataagtttcccagggttccggtatatagcatggaaggatgttaatcactaattc
tatatcaccaggtaacaacattactgattcacttgacaggtttattaaagaaatggagat
aacgttttctgttgtgatgagttctgttacacattcgcagagagtgtcgttaactgttcc
agtcaaaatcccaaaaagtccgtcgggaatgtttaatgacacgtttaaattaaaaatgcg
tacttgttcacaaggcacccatataagttctctatttacgagtacaattttatttgtatt
tagaattacatccatccgacttttctcaaaatgatttattaaaattggaagttcgtttac
tcgaggaacattttcaaaaccaaatctgctagatctgtttcttggaaaggtgagatattt
cttttcattgtccatatgttctgcaaagaactcatcgtaaattttttcacaggatttgaa
taaaccgttttgaggaattccaagtaaagaaaatggtcgttgataaaccgtcaattcagt
gttcacatattcatttaattgctttgcatcgattttaggccatgtaagagagctctcttt
tgtttcgctaaagttccagatatcatccacatccgttacagtaaacaggaaaaagtgcaa
gtatctggacataggcaatttgttaagtgtaattgtttcagagattttttcagaaattat
tttcttgtttgtttcagatcttctggagggtagactttgcattttcgttgaagccttcgg
atgattaggaaaaatgactctatacaagattgtttccaagccaattatattgctggcatt
tttttttacccgagttgttttcacaaatgaagtcgacggggaggagctgttttataagcc
tacttgtcattcagatacatatgaaattattttaaaaaaattttcttctatttggatatt
ggtcaacacatttattttattatgttcattttcattatttttaaagtattggtgttttaa
gactctcgccaaagaaactgtaaaagggtattaaatctatatgaagaatgtatgaaaatg
ccctcagaactgttttaatgtatttttctccatgcatatttgaacataaatattctaagc
caaatatttttctcgtgattagtctgcgttacttctgtcaccacactcatatttttcatg
gtatttgttagaatatctgtggcttttgctttccatcatcacgtcatgctgtatgttgaa
gttgaacaatggtgtgtctgtggttgaatttgttacgaacgcttaatagaaattattgta
catttttctattagtatgagtgctatgaaaatttcctacaaaagttctgttttgagtgtt
aattaaagttgcattgaaaagaatggcggttgtactgtaatttctcaaatcaaagtttta
aagtatgctttgtcacggagatactctacactacgaagttataagtccgtgttttgctga
tttatgtgcttgtgttactatggtttgtcgtgaaaaaggtcgtaggaaatgatgaagtct
gttgtgaagcttgcatgcttgaggtgcctcgagtagatggaaaaaattttgttggttcgg
aagtaacagcgttcggaattgctgtaggcttagtaactttggtcttattttctaagaaca
tcaagttccccttaaaactttgtattggtgacatgattccccttaccaaggagaagttgg
taacaccaaatggtgttgacacattccgcgtgttcacagaattatagaaaaattttgaaa
tagaattcttgcaatctgttcgattgtaaacaaagtagtaaataaaattcgtaaaagaaa
aaagttgctcagaattttcgcgtgaaaataattgagcttcagtatggttttggagatctt
ggaaaatggtttcaatcttgttttggctaaagttaattttaaacaaatgtgaagcaagta
cttcaaacggtattttattgacacaagagtcatccatcgttttgaatgctagtgtagcaa
aaactaaatacaaaaaggaaatattatctaagtaaacgtgacgttttctgtttgttttag
tgggaaattcaaaatgtaatgtccatcgcggaaaattatctagatagagcatatttattt
tagaaaggcaaatattctttttctgggatagacggaatgaccaaaataaaatctgtttaa
aacagttcttagagatgggtatgtcgcaactctgaatatatgttttttcaaaagactcat
aatgaaattttgcgaatttcggccacatggaaaaattcgttaaatttacaaacgagattt
tttcagagcaaacacttaatacaggagtccatatgatcagataactataaaaaagaaaag
aaatcaacgtgaacactagcattgaatacattttgtttttcataaatgtgaattatttag
gaactgtaaatatcctaaaatagttattcatttttttaaccaggatcatgattgcaaaat
gtaccttgtgttggacagtatttgttcacgcgctaatcattttaatgatacttttattaa
ttcttcgttctctaattggatttaacaacgatctttggtcgcaatcacaactagctttta
cttgtctgaataaaagtttatctcatgttccagcataatatcaaaacaatctaaatacat
gataaataccaaacaaaactataattatgataattaaatacagaagaactaacatgattg
aaacttgacttgattttagatctaatgcggtaatttcgaaaacagagccatttcttaaaa
acaataaataatgtgttcgtggattcacatcgataaaatttgtgtccggatctattaatt
ttaatagttgcttgtcatccattatgtatacaaattggataattccgtctatgtcgtcat
attccacaaccaagctttcacaaaacacacaatcgtgggatgaaatattatagattggtt
ttatatttttcaccgaatatttataattagtaggtgtgcaggtagagtttaagggaacaa
cagtgataataattgtagtgcttatgacagtactcgtgacactgaaactagtaccggcta
aaatatattttgaagagatggtgtaagtaatatttggtaatgtgaggaaggcagcttgtt
catttgaaacacaggaaatgcttttaaacatatctaatctcttttttctatatacagaaa
gtgtgttcatcaccttgtttgtgtatgcgtctaggtttttataggataaaatgttgttga
caactctttgagttaaatctttgcgcgtggctgttgcacaaggagaaaacatcgtttcaa
tgtccatgacattatcaagcatatgtgtccaaaaatacatttccaaaggattgcacagac
ttgcgagcaaaacatgaatctttcgcttgatcttttcttggaagactagactgtttccaa
tttctgagagtaaaaacaaatttgcacgttccggttgggttaaatttgtaaacaatttat
gtttttcatataatgtttcaatattgttttctatttctttccatttgttttgtggaactg
taacgattcttccatctgctaaagataaaaatgctagcttagcagagataggaattgtca
gatcagatgtaatataagaataatctactaactggaaattctgaagtttttccatctcag
gatataataaatgactcttagtcattttgaagcacttttctaaaaacctacccatcgtaa
tgatgctttggtgagtattaaggatttccaacagagggaggagtccatctcctcgagtac
tatatagaaaatgagttaagccgaataaaaacattaaatggaatgtgtctttgttaactg
gttttccgcaaaatccctccatgatataaacagttgctaacttattgaatttggctatta
aaaacgagatgtcataattttgtttccaaatatcatccagaaagtctattttgagaaacg
gataaaatctttcaattgttgttttttttgtaattaacaggagatcgtctgagacagtct
gtctatatatgaatgaactttttcgaaaaggtgctttaaaaaaaatacgactaacatttc
caaagataaaaacgacatcatccattcctgtttccactgaaattataaaaaacgatggtg
tcaaagctagcatgaacacagtatttaagtaattataatgtctcataacacatctttctg
ttattgggaatagataatcagtcaagccatttgaaagtgtgcaaatgtattggttgtaat
agagtttgcgaatttccgaaacatttgcaaagtagacatccttttcataaaataaaggta
ataaagacactgtaatcgtttttgtatgcgaaacaggtttgatatttgtctgaaattttt
gtgcatagattttcacagctttctctgttgatgggttaaaaaaacgtgtaatccgatgtt
tatattgatcaaatgattcatcgaaattcacagaatcaaataaattcgagacaaaagtat
atccgaataagcatttgggaatctgataaacccgagtttcgttataatcatggaaattaa
acgttattaaaccaggttgaataatagtttgatttgttttttcatttacgcaaattgaag
aattgagtatattccagtgtttccatccatttattgacacgatgagaagtagactattta
tgtaaaaatacattttctccaatttagagcctggaagataaacgggaagtttgttgtagg
ctacgccttaactttacatattaaatacataacgggataggaatcatagagatattttgg
gtaatatgtctttagaatacttgccccctgttagaagacgtattggtcaatataatcatt
tgagaatctacaaaaaaattctgttgttaaaatccaattttgaaaaattaaatttttttt
tgggcaatctttttccagaagaactgcatgattcaaaaatacatgtatattttgaagtta
gattagggtgccgtattccggattgcattattgtttttaggcattttggtgagaaattat
taaaaactttccattgttatttttttgaattcaaaactacttttgccaaatcaaatctgt
tttcaattcaaaaaaataggacacaaaaaattcaatatttacagggactaaggcaactac
gacaagcaacagattatctacagcaatttgtcatcaaaaatgaaagcttatgtaaggtaa
accctgtaatctgcttttttagacagcatggtttaaaattggactttgtgaaaactttca
tagctaaagaattgcaactgtcttccacgtttctttgcaacctttttacgaaatatcaaa
atgacacagttaagtctattttatcaatttccaatccaaccaattttcgaagggcatgtc
agaaatactctaatttgtaccgaggaagatatgcaacaactccaaaacttgggaattcga
aaacttcgaaaagaaaaagaagaaattcaaaaaaacaagattttaaaaaacttgttaaaa
actgaacttgatgttttgcaagcacatgtacagacagaatgccagaaattaaatacaaat
ttaagagacattgaaaatgcattgcttttagaaaatcaaaaaataattccttctagtgaa
acacgttctgtcttggaagagtctctccaggctaaaactgtcacgcaagtcacaattaca
caaattgatcctgctattcatttcacggaaaatttccgacctgagatgataaaaactttt
tataataatactcagatgtggagctatacgtttggagcttggttttacaaattaaagcga
gctttctttaccgattctaaattaaaaagaatgctaaagttaacatatgttgattctctc
tctattacacaggaattgctgtctatttcaattaatgcattggaacaaattactatttat
cctatgcatgataatttagtgtccgatttagaagctggtttgtgtctactgactgctttt
tttgcatcgtatcctggaactttcttaaccgaaaatattaaattcgtggatgtcattcaa
aatttgtctcaaatttttagatatctaaacaccgaaattttagctacgaaaaacgcgtca
ccacaggatttttattttggattcaatgatccagacaaaatgaaatattttattccgttg
tgtaaagggaggcattatgcaataaatacattcagtaatcatatcttaattaaaattttt
ataaaaaaaggtgtgataaagcaagttcccggagatcaaatgtcgaaaggacatgttgta
atagaatcgaagttgacaggcacgttaacagatgataaattattatattggactcaaatt
ttattgcaaccgaaattgggaaaagaggtgccgatatttgtccatcagcagcagtatttg
cgttctggaattgttgccatagaatccttatatttactttggcaaattttaaactcagaa
agcatttttggaaagagaactgggaaattttatctaacgacaattttcccccatgtaaat
gcagaagatgttacagaaacagaattttcttctgtcaatatccagaattttgagtttctc
atgaaaaactatgtcgtccccacatatttagccaataatgaaagtactatttccacttta
tttccggggttaatcagcattgtagttaacgaaagtgttcgtttaggctgggatcataat
caaaatactttgacacaaactaatgctttgcatagccaaacaaaagacaatccgtttgtt
gaatatatccgttcacaattagaagaaacggcagaacttgcggtactcgagaaacatgat
aaaattctttttcattttgaaaatggcttgaatgtgacactctctttagcacttccacga
cataggttgttcgctatggcatcctcattatttaatgtggctgatttgtatgatttcttg
tattttttggtattaggttttattccagtagcaactgttatttgaagaccaggtgacgtc
tagacatttgttttggatataaatacgcgtggaagtgttaaggagcttcattttaaaaaa
gacacctttcttaagcttttgtaaacatgaaaaatatcgatttaacaaattggaaattac
tggcagaaatatatgaatatctgttttttttctcgtttttctttctttgtctgctggtaa
taatagtggtgaaatttaataacagcaccgttggtcgagaatacacatttagtacttttt
ctggaatgttggtttatattttattgttaccggttaaaatgggaatgttaaccaaaatgt
gggatgtatccaccgattactgtataatcttaatgtttctgagtgatttttcatttatct
tttcgtcctgggcgttaacgctgttggcactggaacgtatcaacaatttttctttttctg
agattaaggtaaacgaaactaaaattctaaaacaaatgtctttcccaattatctgggtta
cttccatctttcaagctgtacaaatttcaatgaaatataagaaatcgcaaatgaatttag
aagatgattactgtttattggctattgaacgctctgcagaagaagcctggatcttattaa
tgtataccgttgtcatcccaactttcattgtttttttctacgtgttaaataagcgatttc
tctttttagaaagagacctgaactcaattgttacacatttaagcttgtttttattttttg
gtgctttatgctttttccctgcttcggtgcttaacgaattcaactgcaatcgattgtttt
acggtctgcatgaattgctcattgtttgtttagagctaaaaattttttatgttcccacta
tgacatatataataagctgtgagaattataggctagctgccaaagcttttttttgtaaat
gttttaaaccttgtttcttgatgccttcgttaagaaaattgcaacaacctacaaaatcta
cacagttttaaaattgtagaggtccaatagaaaacaaatctgataaattacactctgtta
cttttgcttctttctccactatgccacaaaaaactttgaaatcattctgaataaaagtaa
ataatccattcctgtgttctggtttctgttgactaaaagcaccgtgagaaattttgatct
tgtcaaaaaaaattaaataaccaaaccacagatgcttacaaatttttcggataaaaggtt
catatacttcttgcccccagaacttgttgaaatagcgacataattttaataaacggtgat
tgtagatggcaccaatagaaaacattatattcccatcgtgaataatttcagctggaattg
taattgaaagaccaaattcatccaaaaagaaactttctatgatttgtttaacaattccag
tatgatgtaattttttcgagagctgagctgcattttcttcactgaagatatgtttaagga
tttctgatccagatctttgtttaatcatgcaaaagatcttaaaccaaaattcatcaggta
cctttcgattcagaaccactaaatcactcactccgatattgtgcaaagtctctctcaaca
gtaagatttggatgccgtgagaaaacattagggtacacacattctggatgatcaaaatct
cttcttgttttagattaagtaaagattcaccgcttaccaatttcttagtgatatgtaata
ttaaattggaggttgagttgttcgagattatgtattgacctacttgtgtcatcgtaataa
tggaaactgtgctagtggcaggcttcctatgtgtgtatgatgataatgatataaatgata
acttttatctgccaaggaggacgatacaagaagaaatcaattccggaaatggtttgaata
ttccattgaatataaaccacaatgaaaatgccgttataggcacagtctcttctttaagtg
atttacagcacggtttgttcacggttgcccgtgttcaatcaaaggaattccttacaataa
ttaagaaaatagctgtaaaatctaagctgataaccaacacggaagaaaaaactctgccac
cagatcccgaaatagagtgtttaaattcaattttcccaggtttgtcattatcgaacaggg
ttggtggcaatgaacgtgatccgttttttaaacatgtctctatctgtggcgttggtcgtc
gacctggaacaatagctatttttggacgaaatttaaattggattctggatagattttctt
ctattacagaagcggaaaaagaaaagattctgagcacagatcaaagctgtgttcagtttt
ttgccgaggaacaatttaaagtggatttatatgatctgctagcggatagtttagacactt
cgtacataaaagtacgttttccaaaattacagtctgataagcaacttagtggaatttcaa
aatctacttatattaaagcgagtgaaaatttaacggctaacaaccatactattaacgtga
attcaaaagtcacaaaggagacagaagcaacagacagcgtttcacaagatgattgcgcag
tccatgcaccagatttgataagtacgatttgctcgacaacgcacacaacgcatcacgacc
tagtcagaatgaatggctcagctactggcaactcagctagtcttcccgctcctcagtttt
ccgaatgtgtttttttaccgaaagatacattttgctccttactgaatgctacagctgggg
cccaaaataaaaacgtaacgccagctgctccgatatttaaaactgatgaatatataactc
cgtacccagaatctctgagcagaatggattatggaaatagaatgaattatcacataccac
ctccatattggtatccctctatgcctggatttaattataaatcttatcgtggttcccaaa
aacggtgcgctccaacagattcggatgatgaaatgagctttccaggagatcctgactata
cgacaaagaaaaagaagcggtatagagaagatgacgatcgtgaactcactaaagacaaaa
atgatattaaagaactagttgatgcaatagggatgctgcgtcatgaaatttcagcgctaa
agtatattcggtctcagtctcctcagagacagcattgtacagcggtagatacaatgccaa
cgattgaagaaaaaaacgtggcatcacctaaaccatcggttgtaaatgcctcgctaactc
caggtcaagacaggaatcaaaatttgatgcaaagtgatcaatctttattgagtttgaaca
aaaaattgtttgtagaagctttgaataaaatggacaattgaatacaaattatgcgttaat
gtctctgtctgttcccactgggacaaggaaccgtttgcagcccaatgttgccttctaaaa
cagttaatgtgtgtggtaaggcagtgattggtagaaatgtgcgaaggttgtctgttctca
tgcgatatctgactggtacaaggtgttccttagctatgtttaaatgaagagaatttagat
taatagatacgttagttgcagctgtgatatttggtactgtagatagtacaggactatcag
cgacaggtgttgtttccgatctaaagacacttatttgattattttgattggaaatcaaaa
ttctgcttgtctctgtccagccaaaatctatatttgattgatcgtgtgttactatttgac
tgggtaggaaaataagttttcccagttcctgagaataatcaatacggcagttttttttgt
aggctctcatggttacttgaagatgagttctctctttccaagtgaaagtgtttaatgaaa
tcccgtttattaatctcggaataaaaagtcctgcaaatttctgtttagaatcaaaaaatg
ttggaaatgtacatgagaaggggtcagtggtattcgaattaatgttttttgtagaaccta
cggttatgcatgtgccatcgtacgtcattacaggttcttgatttctttccatcacaatgt
gaggaatggtttggataaaatttacttggaaaaagatgtcgctaggaaaattatcaggat
ttaaaagataattgttttcataagatgctcttataacaaggattttttcatgcagcatta
tttgcttaaaataaacatttctgctggatataaattccacttttgcactgttaaaaattt
gatctggtggagttgtttgtaaatctatccaaaattcacacgcgtacatgtaatgcgttg
gttcttcgtgttgtaattctgtccagcgtattctcttaatatgggctcttaatttagttt
gagatccataaagaataaattgagcacggcactctccatgtggaatgtaattgtgctcca
tgcgctcaactatttggacaggaagtgataccaaattaatgctaggaagaaaaaaggcaa
aaagattaataattaaaggaaattgttttaaatctaaatctacatcagatatattttgaa
cagccaaggttacattgccacaatctcttagatcgatatacgtaaagtaggctgctgtaa
agcttccttcatctctgcacatacacacaaatgttgattgttgcgaaagtatgcttagcc
ctgtccttaagcatcttatttcacgaggttttaaaaggattggtgctgtcaattttagtt
gtagaaaatatgaagaccagaccacataacaggattccattcttactttaaatcttttat
tgttgtaaaatacttaaatagttgatattacaattgcatacgtttgaagcggggtgttat
gttcatagagttatgtctaatgttttctgtctcttgtatttgttcgtagggaaagtctgt
catgggatgaactgtcaaaattgggagagagtctgaaaaaaaatcgttccctaaaaagtt
aattcgaaatgaattgaaagcggcttcaacttttgatttgcaatctgcgtgtgctgtagg
atggaaagaatgtggaaattgttctctactgataaagtagacatgaccaattatatcatg
ctccgttacaaatgtctcatttcggcagtacacgtaaattctaaaagtctcacgcggttg
ccaaatgaaaggaaatgagagtacattagatttctttggaatgaatagccctacagcagc
aggattctcaaaggttcctcgtaaattgatttgtgtgatgtgattaggtgtcagtgtcat
tctttcagggaaataaatttccattgttttgaattcttcagaaatattgaaatacggcat
gcaaatgttaagtgcaactgattgcatatttggtttagaaaatcttaagcgtaaagaaca
ctcatccacacagaaacgtgaattcattactttaagataccgtagaaagacaaataacac
cggtgatcgatattcaatcttgtacaccgaaacattgtgttctgatatcatttccacgtt
gcagattggcgttgcgctcgcgaaaaaaacattccaatatttgcagtatgttgtattgaa
ggtgaagatgcagtacatggtttccagtctttgatcattggagtttttcagtaaaggttg
aaattcattcttttcccaagtaattttagttactgtggcatttacgatcagatcaccatt
tttcacagaatataaaattataggagttgttcctaaacccttttcaagataggcaaattg
atgaaatctaagaggatccatattttctttaaagtaacaattatcttgtatcagcaggga
tgacgtaatgttaaaaattggcagggcaaaaatattgacaaagtttatcgattgtatcat
aggaaaaacattaattttgatcacttttttgttttttagaacgtgacccaccaaagttac
gcattctgcattgttttcagttccatcggtaattagcaacagtacaggtctttcgtgcga
aagtatgcaggtaatctctgcgggagaaaaattgagttctggctgcaaatcattaaaatc
cacagtaaactgaattaattgcgataattcagagactggtgttgaattcatttttacaaa
gaaaactagaatatacaaatgattcttaattgttttcacacgttttatagaatctagcaa
gcttctaaggctttttaaaaccgcaatctactttttgaaggggcgtggttatttatattt
gatccagattgcaatttttttttacgagcgctccaaccttttcttaagattaaatctggc
aaatcagagataaaaattttgtctgctaaaaagtacagtgcgtcagattctggatcttct
gagttaagctcaatttcagcagcaaaactatccgtatagttgggatcaaatttagttcgt
aaaatatgcgttgggataaaataaatgctgcctattatgtcatttgtagtcactctctgc
gatctatcactagtcacttttgtggtaaaacttgtagtgggagaccagaaagaagcaata
gactgcactttggaatttgggtctggaacgtagagagcattagcattaaaattataaaaa
gtgcctttaaaatgaagttttttagtttcgccctcatcgaaaagcatcgtgtcttggaaa
aaaacgtcaatttttcttttatcgctacagattttaaagtaatgcatatgcacagttaga
gaaatttcgtttgggattatttcgttgacaaaaccaagtttaagcatgcaatcgtttgga
accatatacgtgttatttttagttacctctgtataacatcgaagatagatttcgagtaga
ggaggagaaaagatcattttaagtacggaaactgttgggtctgaaatagaaaacactttg
cacgttggaaaatctgaaccactccgaacatcgtgaaaccaaaaaggtaaattgtttatg
ttaacagagcagactgtacatagagttgttaatggatggccaggtgttctttcaatcgaa
cgttgataagtacttagtttccattcaatgttaaacatcgtgacggttatttcgtttact
ttatgtggggtttgcgtcactatgaccttttcgtttttgaatcttatcagactaggaaaa
actcccatctgctcttgttctttaacatcatggtttgggatgatgacgatagagctgtta
atttttaacaacggaaatccaaaaaacaagacttttgatggataaatgtgtctattcaga
ttttttaaatgtagttttagttgttgttcttccattaaaggacgagcagaaaaaaaggag
tcagaattccttgaatttatttcagcgctcaaaagtaaaactggttcagtttttgattgg
acatactcgtcaaataataatgtaacattatctttaccctggaattcttctttgtatgga
atttcaatctgaacatattttaagatatcagaagttgcgagagacatggagctgaaataa
aatctgttacaacagacactatttcaaagaactttttattcactctttaaatatacaagt
tgccagcctattgtcagcagaaacatcagccacaatgaaaaacgttttttcttgtgtaag
ggaattgatttggttaatcatggtgaaaaccgttttaattttctgtaattctgttttaat
ttcagtggccttgaaagaactaggttcttgagaaaaatttttttttgctaggagttcttg
acatttaatcaataacatagactgatcttctaaagataatctttctatatatgtttgaac
tatatcaggagccatggtggcaatcatagaaaaagaaatgcatgctgttttcatggaaaa
cgtggacttacaatcattgataacatctggtaacttaattgttacatctctgtactgcaa
agtgcgcagctcatctataattatttgaacttcttcatattttctatgtatggaaaggag
gctgatgcaaagcattcgcacgtttatttccgttgcgacgtctgtagggatcagtaatgg
cagaatcagctcccagttaggtaagacaagtaattgttgcgaaggcttcagaaatggtgg
cagtaaactcaattgatctcccttttccagaggaaatggtccggtatttttgatttcata
ctggtgtccaatttttggacgtattaatattaattggtttccttctactttttgtaagat
tgttaacaccattgtttttaagatatcccttatttgaatataatcggtggttgtagataa
gaccgtgtaaagtcctaaatttgtgttgccaattaaatgacggtgcgacggtattgggat
gacggcattagtgagtttgcataaagttccaatgtcagaaagagtaagcttttgatcaaa
agtacagtagattgaatccatttctatagcagggactcaataatattttgtaacggaata
cactcccctatagcgaaatttgcaaaatgcgtttcacttaactgtgtcattccgttctta
gatcgactctctaatagagcttggttagaggagcaatggattggaaacgcaatttgtaaa
aactgacaaggacgatgagtgacatcgtctgttccttcggaacaagaatactgaatatca
gtgtcgctgtccaggcatgttttagtttttatggaataatcactgataagtttaaacata
aacttatttgtcttaaatatttcagtgtctgtgaaaaagactgcgttaggactgtaactt
tttggattatatcctaattgatctctgtgatttatattatataagacatcagataaagat
ccttcttgagatgcccaaggatttgttgttgccacaaaagcgtcgctatcaactcgagaa
tgatcatacaaagattttctagcttctgactcattatggggatcgacacccatcatacac
gaagcccttcctctaggatttttaggtgttttatagaaattaatatcggaagtcactgga
gtaatgacaacctcgcagattgcttgttggccatgtaaaagtattgattgtgattgctta
tttatcttaccgaaagaaaggatgtttaaagcatcggtttcggaaggattgggtttttca
atgccaacgtgatgcctaacccaactatttacagtagggttggtgtatgcgtgcattgga
aagaccgaaaatagatcttgcactttacttcccatatcagtttttacccttttcaaattt
gcgattgcagtgctggaactaaatcctaatcccatatcaagaaaacttatatgctgcgta
aggttatatgtggttgagatgtcttttacttctgtagataccgttgggtcatcaatcatt
atggatgttgcagatttggagctatacagtaagcaattaatgtcgaaacaatctgttctt
actaaagtcgcagcgaaaccaggatgaattttttgtctgctttgaagaatgatagctatt
ggagacaatttgcaatgcatagtagctaaagtcatgatacttagcaatgaatttgaacaa
caagaagcatagacaaagaacggtgttctttgccaattatggaattcatgagataatgct
tgtggtagaggaaaaccaccgtcatttctttgatagtggggaaatatgtttagataggtt
tgtacttcaatattcattaagccacaaataatagggtctgagaaaaaacgattaaaagga
attggcttgaaataccgtttcaacacattaattggtgatactaaacacagtccattatat
aaaacatgttgtagagatttgaagtttgaagaactaccatgtctttgagaaggatctaaa
gaagattcaatttccaaaatttttgtattctccgttaggtataatatagatttaaagagt
tgtttaccaatgcaagataaatctgtgagtgcatgtgagggaccaacagcttcagttatc
aattcaatcaatacattgttcgtaatcggtaattcgcaaaagttgtcatcaggtaatata
aagggttctgtgtagaagaaatctagaatgaaagatttcacatcaaaacctgcaccacac
atcttgttatttgtcagtgctggtagaaagcagaaataaaaaattttgcttaaaacaatc
gtttcaaaagatggtctatctacgtctgtgaatatttctgttgaatccaataaattcatt
ctattcaggtcagatacttcatagtttcttaatttcactgtattttgggtaaggggagtg
ttaccagctgtgattattgcatttgcttcattttttggaagactgtttagaaatggaggg
aatagacgattatcaaacaaagcgttcacaaatccaaccaatggttccccacacagttgc
tcattaaagtttgaaatagaaattgtccttttcactaattttaagattgaaattatattt
ttgtaatgtgtataagcaattcctggaattgactcatctccaagataggttgtaattaac
caaatcatttcaaaattattgcaaaacaataatatgtgctttatattataccaatacgta
atacattggctgacaacgtctttaagaatctgaaacgctgtcttattaccatggatgaga
agttctatgatatatgctagttcgggataagctgtgttagttaaactttcaacgacgagt
ttcagggtgtagtcataatttaaattatttgtcttggcttgttcgatcatttgattggtc
ctagcttcatgaaaagatgaaggtgctaacggcagaggtatattgcctaacaaaattctt
ggtgaacacaaaacatcagttgatctgtttttttgaatataggtgaaatcaaaaaatgga
tgtagctctgtctttaaagtaaaattttcagatttatagaaatcttctgtggtaagttca
tttttaagcatattcgtcgtcttaggtatttcttttttcatttcatataagttgtataaa
tttgataaaaaggtgcttggaggttctctaacaaattcaacctgacacagttggttaaaa
gattcccccgtaggttttgcagcatttttaaaaattcgctctgagacactacaatcaaaa
ataattggatggcacaatgatggcaatagatcactatagtctattctctgcaaaagctta
tccttattatagaaatagatagatgtgggtagattgttttccattgtatcatttagttta
agcctgctatccatagtgctaaaaccactatccttcgaaatgtataagcccattgggaaa
aaaaacgtcaattccaatttttgttccaaaggatcctcaatgttagtgtttttatacact
ttctttaaatgatctaagacaactgttttatcactcagttgaataatgtttgtctttaga
tcagcatgttgagtttggttttcaaagatttcagattttttgttttggtcttgtgtttca
gtcgcaacgtttttggtataatttgaaaaatccgccataatagcctggtatgctattgca
gtaacagcattttctttccccataacaaatgtgccataagaaacaggtacagacattgtc
atttgtgaaatgtgttgcgatagggcattggacaaaatctgaatcgtattaggagttccg
agtaaaacgccgttaataggtgttccatcttttaaaacatagctattggtgttatttaaa
atgctttcagtggttgaatcaaccatttcacacagatatctgtatataaagcttacatta
gaagttctgttcaaaaaaaataaggaattgatgagtttgtttttaaagttttgaaacata
ttgcttcgctgtactttagaaagaatctgtttactgttgactttgttttctaacatggtt
ttcaggataaactgtggcggtgccttcttaagaatagttttaatgaaagcatatattaac
cctcgttgtaacgaatcagcagaattcttcagcgatcgtaacaccgtatgaatcgcattg
atgttgagcatttgatctaaaattgtgtttttaaaggtgttttctaaatgcgctaaacaa
gcagcacttaattcaaacgatatattgataggatgcttttctgaatacttggtaaccagt
acggttgtttctttaggcgcagttacgtcgtttcctgtagcgactctaggtaattgtata
taaaacagaatttttcccagtgacattttgtctaggtcgttgaaacggataacatttgca
gcaaccgctatggacgtatgaaaaaaatctatccattcagtccgattacagtaaatccca
agtaatgcttcgaaacttatgttataacgatcagagtcgtcaccgtaatacaatcttaag
ttttcaaaaagttgttcagcagtttgtgttctgatatcatcaaacacgtttggagaaaca
tctagttttgggaaaatttcagctgtgcgccaattttccatggttagtaataatgataga
ctcaatatctgaagaaactttaatagtaaagagctacaccgttaatcactgtgctaaaaa
tgttccagtgtttattaactcctatgatttaaccgcagaagtggccaaaaatgaagacgt
gcgattagcgcgacaagttcaaatttcattagagaaaatagatgaagttatagaatcaat
tttttctgcgtctggtcctagcgttgaaaatgtaaaagatcaggcaaagtttgctttgtg
tcgtttactgcttggtcctgtgagtattccgtgctactgcgaagaatgggatgtcaattt
ttatctgacaaaatgtagttataattgcgaaggcccggttctatatatctataaaaatgc
ttctcaatgctgtgaaagcacatatcgtttttctatcatgactaattatcattccactca
catctttagaggattattatcattacaagaatggaatagtcatctatcaaatatcttatg
tacttgttcgaacgtaacaggtgataaatatactgcaacaatctttccaaacaatgcttc
aatttacttggaatattatccgtattttctatgctatctatgcaagcatctgtctatcat
tgatattgagcaatgtactaatgaattgatagcttttcttggtccaaagacttctcaaag
gattataattcactataaactgttattcgggtttcgatctaaaccaatgaatttcactgt
ttctttgttagaacaggttttcacccttgaaatccaaaaactctactattccgttagtaa
gcacaacagtacaacagcagattttttcaatgtcattaccgctaaatttgcagaggacaa
atattttgttctacgaacatttaaattgtctgcgcaaatcactcctggtattcaaagttt
ttgttcattgaaattcaaactccagaccttatatctaaatttgaaaattatgaaaaacac
aaaattatccatttctaatagtttttatcatggtaaaactttatatacactggatgaaaa
gcaacttgtttggagaaatttattgttaatttactatggttacaatttaaaagacaatgt
aaaacaaacacaagaagagagtttgttgtcgatgcattacatacgaatattggaaagatt
gtctctaaaaagttttcgcgaaattaatcaacaatttagatttgaaattccgagttacca
agagaaaactttgcagtttattccaggtggaaatgatttcgcagaaatcacatcggtcac
gcatggagaaacaactgtgaatgcatttaatacaaatagggtcatgaatgtgaaagctgc
tctttcaggagaaatacactgtgttttacatcgtattcctaaaagcatgacacatagttt
tgtgatgtataagcgcacttttaaagaaccctctttaacagtgagtaccttcatttcaaa
tgatgatttcaccacaagttcattgaacattaacattcgaggtccctactgtgatttttt
atatgcattgggtgtgtatagattacatgttaacatacaagatttttttttacctgcttt
tgtttgtaacagtaataattcgatggatttgcatgggctagaaaatcaaggaattgtgcg
aaagcgtaaaaagaaggtttactggataactaattttccttgtatgatctccaattctga
aaaagttaatgttggttggtttaaagcgggaacaggcataatacccaaggtttctggaac
agacttaaaaaatgttcttttgaaagaactcataagcatcggagaaattcccaatattac
ttttgatatggatttacatgctttgttaactcttttagagaaacgaaatatgcatcaggt
tccatttcttattaaacaattttttatgtttcttcgtttaggtcttttagtgggatatgg
acgtaaacaggaaagaaaggtccatcacattatgctattcttaatacaaaagggtttttt
cgatttttcgaagaattcagttgccaacagtaaaattaaacatgcatgcgctctagttgg
aagtcgacttgccaacaatgtgccaaaaattctgtctaagcagaaaaaaatgaaactgga
tcatttgggtcgaaacgcaaacgctttaaccgttttacgttttattgtagaaaatggtta
ttataaaaggaagacaatttttcgcaaacttttgaagtatttagctactacatcttttaa
tgctcatgttcaaactgaaagtaatcgtttactcaacttgatgcacaatgacagcaaaac
aaatttttccagtttggaaagactgtacactttacgttaacaatgagacagcaactgtgc
atgaaatcttgaattccgatttaagtgaactgttacagttaaagacggaatttgtatcta
tgacagacctatgtgtttacattactggatgtataaatcagaatatttccagcatcacga
tatattggcatgcttacagtgaagtaatttatgctttaactggaattatacactgtgaaa
agatttctattgaatgtggaattaaatccacggacaataacattttgtatgaaaagccca
aactgtttttacttcgagaaaatttagcaccaactgaattaaggtggaaatctttaataa
aaacaaagactataaaaagtgctctgtctccaaatcaaaatgagatttttcccaaaatag
cacacaagccgtcaatccttttagagattgaagaagcaccccgatttaaggaaatggtgt
catgtatttggaagttagttgccgaagaggcgaccataacctcaaaaagcgagaatgata
ttgtcaaaacatgcaaaaagcttgctgaatcacaaagatatactttgacaaatggtactg
tgttgcaaaattttatattagtccatgcctgcttatttaagcttggagctgttaattttt
gggaggaaatgaatggaaaattacgtcaacggccagaactaatgtcaaaatcattcactg
gccatgaggaatgtttctataattgttattatttatgcactttgttaaattccatttata
gttacaaaactttattgccagaaattgtagacaataccagatccattcatgtagtagtga
aagcatattattcagagcacatagatgtttcttacaaaattctttcgtactcaacaaaca
tgatgaacttattctctcagtatttaaattttacagatttattgccatatataaataagc
acattaaaattgatgtttcagcatctaagcaagatatgattaaattcttaaatgcctgtt
tgggactttagatttctttaaatgaagtttgtttaccttcatggcacatataaatagcca
ttataatagaaattaaaaggtcatctgaacaggtttgttttttggcattataggttacgt
gttcatttatattaatttggtgaagattcttaatttgttcaatcacatactctattgggt
catacgttatttttattgtaaaggaaattagttcttgtgacgctttaatgtaacctgaat
taaaattcgaaatgaaatattctacggctaatctcttttctctccccagtaaataaaatg
gttgtgcaatttggctctgatctaaagtatggaaaaatgttatgtgcttatatcttataa
ccgatatagtttgtttcaatatgcatgcaattttcaccgccgatgattgattggaattac
cctcgataataattttgagctcagtaaaaaaagggtgtaattctaaaacagctagtatca
tatgtgaggcacattcagcaattgaagcatcggagtttgatagtaaactttctagaaaat
agtgctccattccatatattatatattgatcaccatatgttccgatcgctgctacccctg
ttccagaagcacgtcgattgattgtgtatgctggatcaatatatatgtagagctctttgc
ctaagaatggaattatctgtttgctaattgtgctatatcggaaaaggtcgaattcaatga
gtccttgctctgttatcaaggtatcatttaccacattgcagagagaaccacccattattt
cgtgtttgaaagcaccttctaaaaataggtcggcggtttttttgacgtcagcgttgatgc
tgataaatttcggtttatgtagtcggtaacatgcacaggttgttgcatttcctctgtcat
ttagtatgtgcacatgatcttcacaaacataagatactacagttaacatttcaaaggggg
aattgcttagttttgtcaagaaggaagtagagtgatttccggaatttgtggatgatataa
aaataattttagtcgaagattgtggcagaaatccaagaattgtgctaaacgcgtcttttt
tgataaaatggctttcatcaacgatgagaagattaaagctctgaccacgtatactctgag
aagaaaatgaacggagttttaaacgatataaagactgagtttttatgtaatactaaaaca
gatcttttaacgttgatacaaaaaatttgtctgaactgtgatttcattcttgaaccggta
gaatcttttcctaaaaaaaccgagttggttgcggtgatgtatgatacgctcgcggtggaa
atttttaacgatcttttaaaatataatgaacaaaaaaaagatggacttgcctaaatgtca
gtcaatcacagttgcttgtgaaggagaatgttcgcaaatgtacaatttgcataatcctct
gacatttgaaatgggtttgggaaacatctttatatgtgttcggtgttttaagatacattt
ttgcaatatgctagaagactgcaacctgataaatactcatgaaggatgcgtgtgttcaaa
aaccgggcttttttataacggatggatgccagcctattcacatacctgtatggaacctac
tgaagagccaaatatggagaccgttaatgtagttgtagtgctgttatcatacgtttacag
ttttttaatacaaaataaagccaggtattcaaacattattcgcgacattataaaagatgg
aaagtttatagaacaagtagaaaatgctgttttttgtacatttaataaggtgtttaagaa
ctccaccttgaataagttacctcttactactgtcagtcaactttttgttcagttaataat
tggaggccacgcggaaggcactatttacgataataatgtcattcgtgttagtagaagaaa
gagggaggataacatacttaaaaaaatgaggattgaatatggaaatgcacttgctctgtg
aaacaatgtttacttgcagaaaaaataatattttaccggtacatttatgtattttactgg
atgatgttatacataaagagaaagtaaaagctatagaagggatcttttttcagtgtgtat
tttttaaagaaaagcttgtatatacggaatggacaaaaataaagtttacttatgtgttac
atgatcttgtaatttctcaaatctttaagaatgcctgtattaaagaagtaatacatgggg
cattaattctttcagttcccataaatattgataacctacattttgatacagatattttaa
ttctaaaaattatttacccacattttttgcacgatgatattgtcataaaattatcggaaa
ttttgtctggagcacctcgcatacaaaaaacagtggaaaaaaaacaagaggtggaaaaac
cttttttccatattcctgcaaaacttggagatctcacaaaggaagaccctatttcgttca
accatcatggtccgttagaacctccatcaactgttagaggattaaaacaatctgcgaacg
ttaggcatagtcatccaatatcaaggcctgaaaaagcgaacgtaacctttctaagtgatt
cgtggtacagccaaaatctaaagtgtgacttcatatctgacattcaacaaagacatgtgc
ttgtcattttttggtatgagttatcgaaagggatacaaatgcaaattaaaaatattcaaa
ttcctcctgaaaatttgttttcatcaataacgaattatttagatagagtcaacacatatc
tagacgagattgctgaaagaacttttcgatgtattactactaacatggaaattcagaata
gacatcttccacaaaaatttaatagtcattttcaaatagagtttaattgtactcacttaa
tttatggtatggaattggcgagggatttttggattttgtctttagatagaaatagttgtg
ttttaaaagctatggccagtcattttcttcataaaaaaaaagggagaagctcacttagtt
cgaatgaattttgggctgacttaattgattgcactaccggaaaaaccttatatggagaga
aagtacggtggcaattaaattctgaaacgagcttatactccacattcagaaaaaatcaaa
acatttcatgggaattacagcctaattgttatgcactatatatgtctgagaatttaaagc
tgtattgggtattacccggggggttctgcgtgtctggaacttttaaattaaaagagaacg
atgaatttttcttcgattggcaatttgggatgtcttaggagttttttacaaaatgagtgt
aattggttttcggtgtgtaaaaaaaagttgtaccacgaatatcgttgtgtggcaacatct
tctcctgttttcgctgttgataaatttaaagattgcttgcactgtaatataattatttta
aaaaagaatttggattttgtttttagcttggccataaacggaatacatgccggacagttt
gcaacaaattccattaaactaaaaaaaattataataacaaacgatttggtgtactacata
ttagaattgggatctttaacggtaacggatttacatttcattccaaaatacaatagtgaa
catgtgctgaatgtgcgacctattacgccaaatctaatttatgatacttgttcaattgtt
agttatgacgaagctaaacttttaactgttaaaggacctggagaaaataaattaattcct
ttgggttgtggttcttggtgtctcaacaacattggacgttattatgtgtacacttttgtc
ctggtgtacgatttatatctggcttgctttgaaaaaaacactttgccatcattatctaaa
gtagtttttgatatgatttcctgcaataataaacattgtgttttttgtaaggatcatagt
aaacacgtagaacaaactggcaaaaccgttggatgcactgataatcaagaaacatgtttt
tgttacaccccatgcaagaaaaaaatggctaagatttccaaccaagatctgtcttcatta
ttatgtgatcaagagctcgatttacttgatctaatttaccctgaaaagcccactagtctt
tcaactgatataaatgcttacgtacatggacataagaatcaagaaccagtcgttttaagg
aatacaaactggatattaattcgtcttgacccagcaattagcagattaatactcctttcc
tgtccagtctgtaaacgcatagtaagtaggtaagaaaaatttgttacttacgtgagtgtt
gtaacaactagcaaacagtgctgtactttttattgtttcgtgttcgatagtaatcacatt
atcttgacaggtgatattcttttgcgggaaaaaacgtctacatttaaattcaacatcttt
cataacaaagtgcgaaacgtgtttttgatgtgcaacataaccaatgctgattccttctaa
attctttaataaaaaacaaataactggtatcatgaaccatgttttaccgtgtcttctggg
aactagaaaaacactagctttctgtttaagtatgtttacgctgctttcgtttataaactc
tatgtcaaatttatattttaagtaatcaaggacatgattggccagtgtgggtaatttcgt
aacagagatgaaaaaaattatgtgtataagaatgctcttttgaaatggctctagtttaat
tctttcctttttattggtgttctcaaaatcaccgcagatccatctttgaaaatcttgaat
aaatttttcgatctgtaaaaacatgggatttctgtaaaaacttgtttgtagctctagatg
tttttgatattgtacttctgtatttttctctatgattgcagtaaatttgagctttgacaa
agcgcagttcaaggggtcgcatattgcaattttagattttacgtgccgttggcgatcaca
aaagagatataaaggtttaacatgcctgcaatatgcatgtgtaaagccaagttctggagt
taatataataaatcgtttttggcaaaatatcgcgctgtttggaaaagttgaagaaatctt
tacgtcctgttcatgtttccaaattatagactgatacgctttctgaattgcatctatatc
gcatgatcgcaacatggacacagatattgctctagctgcaatttataaagaaacgactaa
attaaatgaaaaggatgctaaaattttctcggaggcagtgcagaccgcactaactgtgtg
taaagcaaccgctcctaatacacgtctaaaactcgttgaaacaccaactaataacttctt
actagtaacaaatgttgttccatcagaaacttcgaaagcaacgactgaagcaaatcttaa
tattgatgcagcgttggaaaaactggcgtcttcctttaatacagcggtacctgtaaaatc
atccaaaaagtatttgttgcaaaatgtgagaaaaatgaccagtgagaacatcgctctaac
tggatcatatatcatctatacgaaaaaacacatcgaggtggcgtttctgttagataagtc
tgattttgttcaggatattttacgttatgctgaaacacccagtcttctaggacataccga
tgtacgtgatttagaatgtttgttatggttagctttttgtggtcctatgagttattgtca
ggctgataattgttttggactaaataaggcggggtataacgcccctttcccaatattgtt
tccaccatgcatgtatgaaagaaatatgaaccttagtgtattttttgggttattgcaaat
ttatgtgttctctttgtatagagattttagtgtcgaaaattcaaatttacagcaaggtat
taaaaagcgtattaagttggttctgtcagatttacgggccaaagaaagaatttgtgagga
agagataggaaattttccattggcggctcaaatatgcctgttttgtgcattatatagaca
aaataggctctgtatggaatatgccgcaaacaatctaagtatgagtgtgttcagtccaat
aatattaaaggactgtacatttatgcaaacaacagttaccataactcaaatcttgccagg
ttctaaggaagcaataattttcccagtttacgatataggcaaattattatcagctcttgt
tttttcagagaacggtgtacttttgaaactataatgtcactgcatgaattaataaaacaa
actatgtccaaaaatttagaaaaaaaacattatgagttgttaaaattaaaacttggtgaa
gatcatcctcttagcgttcgacagcaaattcacgctctcaatcaaaatcttgtatcagaa
aatctcgaacagtcccagataattacttctttgacaaaaatgttaaaggatcaaaagctg
cagctgaaagcgcaaaggaaaaatgctgctcagctagaatgtgtagatttggatgacatt
ttggatacggcagcggaagtgaaatccgtcaccgacaatataaaagaaactttactggcc
ggattagaatcagactaaatatggagcagcttaagacaccccaaaatcaaaaaacacgtc
caagaaatatgcttcctaaaaaaaaaggaaaagaacttaaaaaaaggccttgtaaagtaa
aacgtaaattatttggttccgaaaacatcagacctaacaaaaaaatacctctggcttcag
acgtggataacgaattggaaaaaaaacggggctcgatgatacgaaaacggtctgagacgg
acttatgtccagatccatctgtaacagacctcctatgtcatgaatctttgactgtatctc
caaagtttgaacgagatggattgagtgcatgcacggaatttgagaattttatggatacaa
ggaaaatcgtgttaagtcgaaatgaaaagtctgtgacagatttaagtgcacattaccccg
ttttatgtaatcttggaatttttgagcgtattcattcaccctttttgttttcaatacaca
ttgatactcagtcattttcagttgtctatgttccacataaggaaagttcctgttctcagt
tttgcgagccagaaaaaaacatggcacggattttaggaagcggatcatatggaatggtat
atgatttgaacaatgttgcaattaaagcttctgatgacttagagagctgcatttcttctt
atgtgtctggagtagttcgtgcaaaagccggagctcaattaacctcacgcgaatgcgtgt
ttaaaagtcttttgatatgtaattctgtctgcctgaaccataaaatctccctttccaaaa
cttatgatacagatttatataaatttacagactggaaattggaaaacgttgaaaattatt
actctattttttgcaaccttgcagaagctgttcgttttttaaacatggtgtgtaaaatca
accattgtgatatttcactagcaaatattttgatacaccacaaggaaggtattattttgg
aggctgtgttagctgattacagtttagctgaagtacacccacagtataatggaaaatgtg
gaatactaagacaatttgatcataggatccagattgtgcctaaaagttataataaattgt
gtgacatgtttaatccaggtttcagacccatgatagctcacaaaataattttggtcgaag
tttatgcagaatttgatggtaagggcaatccagtgagacattgtaatctagatctttgtg
cactagcgcaagtatttttattatgtgtcatcagaatgttggatgaacgcggatgccgtg
aggcgcaaaaatattatgaaaatcgattgttcacgtactcaaatgaagcttgtactttga
atccaatcaaataccctttagaatataaagatgcttgttgcaaagttttagctgagcact
tagttttatttggcattcttttttatcgtgaggtggtggatatgtttgaaaacttgtatg
actttctgcacgcaagtggtgatttaagcgtaagagatttactcgaggaaacatatgtaa
atgacagtagagatgttagaagacaaccaatcaggtataggcacgcccaattacaaagac
acgaaattggtcaaatacttttaaatgatctgcaacaattgctttccattataactattt
cagatttagagaaggatccatattctgtatttcgggtgtaacatggcaatagattacgca
caaatttcttgtaatttggcttctattatagaagaggactcggtctttttatttctaata
gacaaattaaacaatctggacatttcaagaaggaaaatttcatttaattttatccgtctg
tgttatacttattatatcttaataaagtttaattctcgcttcaaagataccttcttagcc
agatcgttcattgattatatgcatcaaaacatatcagattttatcgatgagaatgttgag
ctatctgatttatatagcaatatttatgtccgcttacaagatgcgagtccaaaagttgtt
aagaatctatttaaaatattagaacgagagacaagaggacagtcaacaaatccactctgg
cacgctatgcgaaaaaattgcatcacggcaactaaaatttatgacatctatatctctaaa
tctttttcgggtatacaggagcattcttatttaggagatgcggttttatatggaattaaa
catgaacgcatcatagaacacctgttaaagacattctttgtgaaaaagccctggatatct
aaaacacttggtttattattagatccttcatctggagtgtttggtgcatccatagattct
tattatggaatctcttttaatgacaacaacctgatagaagtaggggataaagttgttata
tttgaattgaaatttagatataaatatctgagagaaaaaaacgatctatttgtttccgag
ctgttacaaaatccgtcagaaattgctttagctaaattcatcttatcacatccaatacca
gctatagagtatagagaaaatggaaagatgccctcggcaagagaatatttaatcactaac
aatcctctatacgattctggtaaaaaacgtcgtgcttgcttgactcccaaaaatttgacg
ttcgacattacacgactaattcccatgaacgaaaaaaatgtgtcaacggcaattattttt
gatgtcgttaaagactgtatattaaacacattggttgcataccaaaaagctatttttact
attgatgcttttataaatcctaggcatagatattattttcagagtattttacagcaatat
gtaatgactcaattttatatacaggatcacgataatccagaaaatattgaaaaagagaat
ttaccctcggtttatattgtatctgccatatttcgaaaaagagaagacgacgaaaaaaac
tgtcgcttgctaattgaggacacagaatatttagaagaagaaatccctttaattttattg
attactccaattactattgacgctgaatttacttcacgagtaatcaaagatatatgctgt
atctgggaaaataaaattgcacaacagacaaatttaaaaatatgggctcaaagtgctgta
agacaatacatggcggcatcttcagcaaggccgaagacaccttagtagactataaaggaa
aatatattaatcttgaaaaagaattttctgctttaagtgatactgaatctgaagaagagt
tgcaactagagaagccacttctaaataaacaagattctagcgtttcgttaacccagaaga
aacttgaaaatcaatccaaataaacgtccattgattaaaaaccctttattcatttgcttc
ttctaatacatctaggtcttccactgttgtaggtaatttcttataattatgatgtttccg
cataaaaaatctaattaatctgcatataataaaggaaagacaaactatggtgatcacagc
tagattgactatgaatttgacagtccattccgttttaaatagtgaatcatattttagtat
tgggtaggttaagcctaggataccaaacaaaattccaaaatgtaaaccaaattgaacctt
aacatactgatgtaaaattaattcaatcaccaaagagtatacaaaagacataacaaaaaa
ggtgttgatagatgcgaaagccactgttgatgatttaatatagaaattgttacctaaacc
tagacaaatcgtaattgcaaacaccatactggaaaaacccaacattagttctatcatatt
gattatgatagttttatattttattgtgcctttgagttttgggtggatccgtttcaatac
gaagaaagatctttcagaggattgatactgtgttatcatagtcaatgtgaaagctgtgaa
gcaaatgaaaaacaggcaatacgtaaaagctgcgagggtgactagtcgaaaagaaagaca
ggtgacaaagaactgatatgtatccatagttaaaacaaattggaaacacgataaactatc
ccccatccaagttatatcccttgtagattgattgatgttgggagttttttcggaagagaa
tacttttacgcaacaaactatatagtatactaagatgaagaaaaagcagatatccatgaa
aacaacatagcagataagttggataggatttaggtagagttgtggcgttaggctgcggat
gtcattccgtatagagaggttgatggctttcatatcattgatttcataatatgcgcatgg
gaatcccaaattgggaaagtgaacagccactaaatgcactgtgacgttgacatacgttaa
acaagcacagattatacttaagacccaaattctcatattaatcacatctactctgctcaa
tgccattgtggggatctgtcaaatggaaactcagcttcaaaatgatcaattatttttgga
atggtttggacaaaatttgttggattgccactttgcacaaaacgtttcagtgtatttgca
agatgcttcaatggttcattttaaaaccttttctgaacaaataaaaattataagagctcc
aatgggttctggcaaaacctctgcattgatagaattcttgaaaactgtttcatatattga
ttctgtccttgttatttcctgtcgtaaaacttttgctgcagaacttttaaatagattcaa
gaagaatgatttgaacgatttctatctgtacagcgaaattaaagagcgtcaaatcaacaa
gaacaaactgataattcaagtagaaagtttacatcgtgttaccaggaattatcatgtttt
aatactagatgaaataatgtctattataaaacagttctattcaaaaaccatgactaaagt
caaggaagtagatgctaagcttttaacgctcattagaaattcaacacagatcgtagctat
ggatgcaacagtcaatcgttatgtggtggattttttctctctctgtatgccgcattttaa
gtctgcattgatcataaatacgtttgtaagcgcgaatttttctaatagatctgcttattt
ttgtccaacttttatagatgggaatcttgcattttatggaattctaaaacaaaaattagg
cttaggaaaaaacatttgcttattttgtagcacagttacatctgccgatttcatgtcaga
attgttaaaaactgatttcccggataaaaaaattttgcttttaacttctaagcagggcaa
atgtcattctgtcgagagttggataaactataatattgttatttatacatctattgtaac
ggtcgggctcagttttgactttctacatttttcagctatgtttgtttacattcatttggt
aaaaggtggccctgatatggtttcggtttttcaatcaatgggtagagttagaaaggtcac
agacaacgaaatttttatttatttgaatcctgcattaattcaggtgcctctttctgtatc
ccctatttcgattccacaatgctatgattggacactttttgaaaagtcaatcctacaatg
cagctgtatggattttaataaaaaatgtctcagtgcacaaaactacttgtctaattccat
gataaaacaattttttagaattaggcattatattgaaaaaactacgctattaaatcttcc
tgatagtctctatcttttatgtcttttattggatagtaattcaattaaagttcacatcga
tggagacgtctttcctatagctaaagaaaaattctacgcatttacaaaaatgttggttca
aggttgccatttttttgaaaagaagaaaacagactttgtagaaaatactatgacactgaa
agaattgctttctaatacaaatattactgttaacggagaattctatgaacttggaaattt
ccaagttcataaagattacattgttaatttaaataatttccagaatttatttttgaaaaa
tgatgttgacatttttgtaattgaagagattatgcttactttaaaatctgaaattaggag
gtttgtttttataaatgctttgctacaaaaatatgttgccaccggtatcgatgtggaaaa
gattaaagcgttttttaaatcccgaatcaaaacatttactctacctgaaaactatatatg
tagcaagttttatttattaagtgatatttcaggcgtacatgaatgtggtatgttgatgga
tgtagcttttttagcagaatctattagagcggatttaaatttacagtcctgtacagatac
gcaaactgacatctcagaagatgctatcttactttgcgctgcaagaagatcatctgaaat
ccttaggattttacaaattgtttttacaacgcacgtgcaattatttgaaaaatacaacag
ttatacgttatatttgttcaataggttaaagggaatgcaattaaatacctggtcactgtc
gattgcaaaattcagtgtttcaataataaggatgtttttcaaatgtgcctttaatatgaa
tctggttaagagtaaacccagatatatcgttgggaagccatttagaagtctaacgaaaag
ggaaatagaaactttacttgacatgtggcacgtatcaagaaccaatctgaaaacctacaa
agagttacgtaaggctctgacagaagcttcaaaaaaaagacaaagaaaaaaaatttataa
attactaggtcacaatataagttcttatatcagtgaaactggttgtctcttccagcatgc
agatgcggggatgtgtttgtcatctgggtgtctattgcgttcataacgattggaaaaata
aacaatatagagtaccaatttatcaatgcctgttttttaatgctgagactcactccttgc
atacttttttggttattggaaatgagatttctgaaaatctccttgataagatttccattt
caaaagaaaaaatctttatgtgggatttgaatgaacaaataatgagtataactcaaaaga
cagagtcaatctgtgaactgatgtttggcaacaaacaaataattcaaaaactatccagaa
catttattttcttaacaattattttaaattctaatatgtatgaaataatagatgtctgca
tagacagtaatgcggttttgtacatgccagacttaagaccaatgataataagatgtgttg
gaaactattcgaaaatatcttctgaactattgtcagattcagactgcacacaggcgacaa
agaaaatgcgatttgattatcacgtcacaaacttttgtttctcattaaatgtcaatggta
aaaaagtactgttttctagtacagagtcttcagaaagtattttagaaaaattgcttgagt
ttttcacaatacaaacatataaattggcagaagaacaattcttaatggtgacacctaaaa
acttttttaccgtcttatttgatgaggacatgtgtctacttttgctgcaaacagttgtta
gttttttgtatgacaatctatttcgaaataagttagttgtgaaacaagttcatgattaca
ttggtccagatttgtggccgcaaggacatgagagggcagtttattttgtagggtttccta
atatgtggtttttatcgatttacgatctggacaacaagataccttgtattaaaaatattt
gcaatagaattttactttactgtggcctgccagatagtctaggaccagatggttgccaga
gtgttccaagtacgcagtgtgtggatgaattcgaagaccttcccaatttgggagcattac
aatatttgaaatataatagtttggttgttacaatggaaacagtagaaaattctgagaatg
tgtattatttttttggagagcaggatctgtttattgtcaaattggtagacattattcaat
ctttgttggaactatatgttcctaaaagttttctcccagattttagcgatgcttatataa
aaagtgaaatcttattgaaatttatatctcgacttcacaaaaaatctaacaacatttttt
gtaagatcgtaaaaaaaatcacagagtttttgagatgttttttaaacgcgtgtcgattaa
tggatcttaattggatgtttattagaaacatgcatattgtgtattttataggtccaaaaa
aggatccttctgtagtacttcctctgttaaaaacgtctgtggaaagttgttggaaaaaaa
ttctcaattcttcaagaactccagtagtgaacataaattacatccctggttacaatttcc
tacacagctcatgtagctttttgacaagcggagacatcaatagtgaagattctcattgga
ctatcacagctagcaagtgtttatataattgtttaggggcaagtcagattacagtagatt
ttaaaaatatttacacaaatttccagcagatggttagcgtttttctaagtcacagatacg
aaaataaatattggatcgaatattttgagcccaacaactattttctagagacacacgaag
gtttactagactgtaatagatatacagctgtctggacaacagaaaacaaactaataagac
aatctgttggttatccattaacggataaaatagattttattcattacatccaggttgtga
tagaaattttcaaaaagtggctcttaacaaaatatagtcaacaagagtatgcagaaactg
ttagattaggaagtaagatcatctctgatcatttacatttgtttaatgtaaactagtttt
ttctatttctgtcatcttatattcctttgaaaaggcatcgcatatagcgctttttaaaaa
atctattaaatatttagagtcgtcttgcaaacgtctcgtgtttagtgatagagtacatgt
gtcgtcattgtcgtgagatttgaaaaaaagatttaacatgtgtatatttgctgtttttga
ctcataatagagctgaataatgggtggaactttatccagtacgtcttgctgtttgtcatc
gtaaaaaatgtatcttaaaatactaatcaatttttgacaggtgcaggctagaagtttaga
gactggcagagttacactgatttttttaataatatctcgtaatttaagtagtgtctgccc
ttttattggtagattttctagagcatatacaataccacagagtaaaaactccgtgtcttc
ctttaaaatcaaataaatgattcttcgtttacattgagttttactcagccgaatctcttc
tagcgtatcttcggaatcaagaagaataatgccaatgaagcctagaaaccctaatgtttt
ctcacatatgcttttataggatttgccatttacaattgtgccatcttccaaatgaaacca
tacatcatcatttccaaccgaaatatcaattaaaggtaaatttttaatggaaacgtgttc
ggcgtgtttgtttagttcacagatattccggacgcttgatatattgaatatgtctagagt
ttcgaatccttttaagcttgctggcaacgtcatcttgcggatattgaaaatcttctgggt
ttgtggatcctaaatcaggtgtcaaagtcaaatcactttgtttctgagtatgtattaaat
gcgaaagctcgttaatctgccgtatatagattaatcttaaataatgcttaattttacagt
ttgagtacacagctaacataatctcttttagagagaggaacagaaactcttctgggagca
gttcaaaatgtcttaattttagaacatgtttcatgaagggtataagaagcaattctagcg
tgtaatttgaatatgagatgctgtcttcctgtccttgattgttgacattttttcgtagac
ggaatgtccttgtgtattcagtttcccataattgatcaatttttttgtctgcgtattcaa
tatctggaatatattgtgaaaaaaaactgtttgccacagctctggtgtcgtctattgata
cactagtgaatgggagactttgaactttgttcagagctttagcgagagacaagctttcaa
tatctgaatctaaagtaaagtcatgtttagaagtttcggataaatttattaatgaatgca
tgtctttaatcttattttcaaatagccgatttgcagttttcagtgtttcgatttcgtcca
gttgtgattgaatctgttcctccatgcattttatgatttgttttttgaagatatctctaa
tatcgcgatcattattgtcctgcccacgacgttgcaaatttcctttgctgattaataatt
tattttggtcaattatagacggcgtgatgtcttgtaaaaaaccctcaatactatctgtta
ttccaattttagatttactatcggacaagtttaatagaaactttataagactttttttcg
catcgctggttttttcctctctttctataagttctagaatttttttgttatcaacactgt
tctttgatgtagttaaaactttaattggaaaagtattcagcaattgacacattttacggt
gcctgtgtaggttttcgtgtttattcaattctgagtataagtgagctaggggtgttgtaa
acagcaattgattatttatgaaatatggtgcactgtaaacaaagtactctagttccttgt
tattggagagacaggttatattgccgtttgacttgtttcgataaatgtttatgttggtga
aatcggcaatagatgttgaggagatctgtgttaaaatgtgcagtagaaagttctgtttgt
ttcgtatgatttcttgaatcaatctagaggaaatactttttgctaagggtgtcagcgtaa
ccttgttttttggtaatgtgacaattggtgttattccaatcgtacaaatccaatcaatgt
atttattataaatgtcgttatcgagattttgaaggatgtagtttatcgtttgcaaaatgc
cttccaggattacctgtttgattgcataataccagatattaaaatattcttgaaatgaca
tgcctttactgcggaacggaaatgctttcagatgacgttgccattcagcattgatctgct
ggatggatatactattcaagagagtgtgtgacagtgtgtaaaacatttgcttcttaaaga
cagccgagtctctaagaacactgtgtatagattgtcccttaaagaattcttttttaccgt
gtagcatttctataaattttatagtcttaatagaaggaaataaaatgtcattgtcttcat
tattcaatggtaaatatgacacaaaattccttttaaacatgtcatctgctgctaaggtgg
agttgattgttgagaaagttgcagctttagctgatgcctgtttagagacgccgttaccaa
ctgactggtttcgtaacattcttgatcctgaattagaatttaatagcaattttgaagaaa
ttcattctataggtgatgaagaatttgctcaaccgttgccatttttaccttttagagtat
tattaataaccggtactgcgggtgcgggcaaaacaagcagcattcaaaccttagcagcta
atagtgattgtcttataactgctaccacttccattgctgctcaaaatcttagtggtttat
tgaacagaaccaaatctgcgcaagtgaaaacaatttttaaaacatttggttttaatagtt
cacatgtatctatgaatgaaagaattagttgttcagtaacaactttagattcgattgcgg
atcagcaaaaacatgatttatctacatattggaacgtcatcgcagatatagcggaaagag
ctttgaatgcagcaaatgggaaagccaaagtgatacctgatctatgtgaaagcagtgtga
ttgtgattgatgaagcaggagtgatcttaaggcacattttgcatacagttgtcttttttt
attggttttataacggtcttcataaaacacagctctataaaaatagagttattccttgta
ttgtatgtgttggatctcctacacaaagtggggctttaatttcatcgtttaatccgttaa
cacaaaataaagacgtaaagaaaggatttgatatcttatccgctttaatatgtgacgaca
ttctatcaaattactgtaaaatatcagaaaattgggtgatttttgttaataataaacgat
gcactgatgtggaattcggcgaatttttaaaacatatagaatttggtttgccattgaaac
ctgaattgattgagtatgttgataggtttgttagaccggcaacttatattagaaatccta
caaacgaaattggaatgacgcgtttatttttatcacattacgaagttaagtcatatttta
aagttttacatgagcaggtcgaactgacaaataaagataatctttttacttttcctgttt
atttcataattcagaataaagcatttgaagattacaaaaatgaaatttcaaattttactt
tagagattgaaccatggtttaaaactaatttacacagattaaatacttattcccaattcg
ctgatcaagatttgtctaagaccatacaaatcgaagaaattgtattagatgatggttcgg
tagaggaaactttgataacgtgtcatttgaaacatataaaacatagttctattggcgtta
cttccagaacaaaatcttcaactgttgggttttcagggacatatgaaaaatttgtggagc
ttctgcaaagtgatttatttattgaaaaaacagcatgcgaatatagcgtgcacgcctatt
ccttcttgacaggtttaatgtatgggggtatgtattctttctgtttatccgaattcacga
cttctgaagtaatgacagaaataagaaagatcaaattgcccaatattgattttctacaaa
caatgacagctgaagtttctttgcaaaccttcgatgaatcagacgaatactatgatctac
acattgcacctacagatgaagaaatgttagcttcggatccgtgcccagatcctttttttt
taaagtacaagcaacttccattaacgaatgttctaacatttgaagaaatcagttaccttt
atacagtatttaaagagattttcatttctagatttgcaattctacaaaggcacagtaaag
aaatgttcggcaagagtaatttaatcacatataataggaataatgtttcgagcaaaagat
gtggggagatatgttcacatgttaaaagcttctacggcatgttaacatatgctgtgcctg
ctaataattatactttggaaggatatacttatgataatgtgattttcttagggacggata
aaatgcttcctccgataatttacaaaagaggtttacccaaaattgttatcaaggatgaaa
tgggctttatttcgatcttagacaacaatgtatcaaaacttactgacactgtcaatggta
acagttttcatatctgtacaaccatagattacgccatagtttctaaagttgcaatgactg
tgacaaaaagtcaaggcttatctatacaaagggttgccttagattttggaaatgatccta
aaaatttaaagttgagttctatatatgttggtatgtcaagagttgttgatccaaataatt
taattatgaatctgaaccctttacggttgaactatgaaaatgataatattattgcttcac
atattgtaaaggccttaaaaaataaagatactatgcttattttttaaatgccagagtttg
tgttgattgacgtatttttttaaactaagttgaaattaagtttttcatgtatcgatgtgc
ttttttctggtatgtttttaatggttggcaattgtaaaaataaagacatgaatcaatgat
ttggtatacactattttattgcgaaaatgataaatactctgggtccggaagttgaggctt
ttagaaatctttcatcttctgaatctgcaaagaaaaaaaatgcttagaatcttttgcaca
tctagataaagtaggtaaaaaataaatataaacaaaatttaccgtctgcgtagttatttg
ttccagttgaatgaggactgcagtattcttatgccaggtttttcaaagacgcagtctaaa
agtaaagggaaaaacttttccggagtatacaaatgtactccggattgcgcaggcgtgttt
attctacatttaaaattgatggcagttagcggtgtcaggtggtatgtatggtgtctattt
taagtatgtcagaaatcaactaaagttccttttccacacactactgaaggttgtatgaat
atcacaattcacaattttataacaatctagagttgctttttaaggtatggaaaaagccta
tgaaatcatgcaaaatgctgataattgtacattcagaaagctaaaactacttattcttaa
tatctatgacttaaccttaaaaatctatgacaaaacctattgattattcttaacagctat
tattaaaattaaaagtgattaactattcttaaaaactatgattttaccccattccccacc
cccacccccacccttcttgattatatcccggaccccactaaatggattgtctttgtatta
tgttggtgtgttgcccactacacactgaaacatagtacaagggctaactcttaatggtta
caagtatgcagctcaaaatcgtaatggttctgatctttcttgtacatgttcaagttttcg
gcggttaagatgctttagagatagttcaagattttagattcaaaacatcacttatctcca
cagatcatttccaagcaattgtacagaaagatagaatgtcaatgagaacagccgttctca
ttgtcttcacaaagtgaggttcagatcatgacatagtagccgtaaatggctactgtggtt
tacattataaatgagaacagccgttcccatagttttaaaatgaggtttaaaacatacagt
agccattacatggttactgtggtccaaaacgcggtatccgaatcgcaatccacaatacac
agtcccgttgttcaaaaagttatgcagttggcggtcttaatcaggtatgagatggtatgg
caatacacgttgtaaaaattctgagatttgaaacaatgatgtcactgttgtaggatatcc
tgtagtttttgatggttttttggttgatgacttacacaagatcaaaagttactggtaatc
cttagtgttagatcttacatgatatgacaagagaaaaaaagctatatatgggaagggata
acccatatcaaacaagaaaagttaaagagaagaaactatgagatgggagaacctataaca
aatacacttttaagattggggtgggtgaacagggcataactgtagcaataaaaccagtga
ccgacagttacattccttcataaaaactaacgtgatagcaaaaaaaatatacataaataa
agaagatggcttttcaagtgataatggcagtctagatacacttatattcgtgagaggtgt
gtcagtccatatacaacttttcctattacctcgtctaaaaaaggcaacctaaaactggct
gttttacctgggatgatttaaatatagaataaacattcacctaccttgttttcttctctg
aagagtagtagtgttgactgcattgtctccgtgtatcttgatccaatagagctttatcta
ataaatacaaaaaaggaaaaatccgtatattccataacttgttaagtacaatttccataa
aaattgaaaaaatatatcgtttagatgttatacaaaagtttatcgttttaactaatcatt
gtctattttcagacatcgatacagagtttgatatttacgagtttttcgaaagattaaatt
tcaatctcacctctttcgctgtcttaacagttcatgtagatcgcgggctttataaacaaa
tgctttccagttttccacgccctgggggatatgacgcaatttccttcatccgtgaacttg
tcgtgtttgcggttaaactcgcggaagtaaaccgttattttttctcgaacggtaaaatac
aaaaacggtttatgcgaaacaatttcaggcaaatatcattgcgactttttaaaaacgatt
taagttatgagggtttttgttggctacattccggaaatcaattttcatgtcagaaagcat
aaaagggagatgcttttgtgtcaggaagcaactttatcagtcaagaactgtgaagtacat
tccttgagaaatcacttagactcgtagtaagaagtgagtttttcagtgagtggaagcagg
taagtataaaatttccctattctatttcaacctgtactcgactctgaatacgttatttct
tttattgacagaatgattgcggaggatagagaatatggaacgtttgaatctgtaacccag
gcttatcagcagatcattagtcatactttacagctgagacgatatgaatttgaaactggg
tgcatgattatgttttctgctaattctggaaaatgtgagatgctctctaatggttggatt
tcaatgatttcatggacttcagaaaccgatacggccggctcattgacattggatatttgt
actgagggagggcagtgcaaaacttacagtgccagaggtcatatattatgttctaaaaac
atcacttcaatttctcagaaaaacgagggaaaggaaaaagttttgacgatttgtcatgac
aatggaaaattgcatttaacttatatcacagttctaaaaagcggccttgattgtgatatc
aaagaccaaaaactggagaaactgtttgaaaaagaacatgcagaacgaaaaaagcaagat
gatgattataaaaaaaaagctcttaaacaaaaagataaacgccgttctgagcaaaaaatt
ttggaagactgtgataaaaaagatgaaaaaaaaagaatggatgacaccgaaaaaagaaaa
ctacaagaggaccgtcgaaacgaaaaacaagacctaaaaaaaagagtagatgacaccgaa
aaaagaaaattagaagatgaccgtcgaaacgaaaaacaagacctcgaaggttagttgcct
tttttctaaatcactagtcctaaatatgacttgttgaatttttgtagtgtctaaggtttt
tacataaacatgttttcttagatgcatccaaagaaaaaaggatgaaagtgcatcacgaaa
aacgtcatgcggaagaacaagcaaacgaagaggttgcttcttcgagtcagttatcaagta
gaataccagagggtgcgttatcgcccactatttctattgatcttcaggaatatcaagaat
ttgaggattttgacaagcgcatttgtgggcaggtgggtggagttttgggtttatgatgca
tttttattgcagttttttatgtggttaaagatgtttctttcttttaggggaagaatcaag
acgctgtatgcaagaaagtccaaagtgatgaaagtttttgtataaataaaccgttagagc
agtttagagagaaactaataaaaattactcatgaagctgtacaacagtcactgttacaat
cgcggggaaaaaatgaggataataaaaaagatgttacccaaaatgtaaaattcgctgatg
aaaatatgaatttcgcagggggttctaaatgtacttctaaaactaagcatattgaagatc
aacaaatacagtttggggcacaaaatagatttgttcctatatgtgaaataaaaccattta
ttgatgtcaaccttttaaaatcaaatgtaagaggtagaaggagtactcgtggaagaagaa
actcaaactccgctagattttcggcctctacttttgaacaaccaattgaaacttctgaga
tgctgacggtttcgactcgatccagaggacgttccaggggaaggccaagaggcagaggca
gatccagaaacatgtcaatgagacaaactccaagagaagttgaagacatgttaccgattg
ttttggacagtgacagtgacacggagactttaaggcgtaatgaagatttattggcgtctt
ccatattacagactttataaatcgtttgttatgttccaatcaattggacatttgttgtgg
atttgtaaatatttatttgcttttaaaaaatgaccacaaccgataaaaggtgtttttgat
ccttttgttctcggagatggatgtgcacattccaaaatcaagtgtttctttgaatctatt
aaagacacgagtttgcgagcctgtgatccccacaacataaaaactaagttttgcattttt
tctgatagttggttaataattcggttgctcaaaacttgccatccaatcgcttcatgggac
attggtactccccttataactgtgaaaacagtgttgagtaacaaaacgccttgggcacac
caagattttaaagatccgtgggctggagctttaaaattctctattgttctttcaagttct
gcaaaaatggtttttaaagaattcggaggggaacatcctctcacagtgctgaaagctaat
ccgtgacctctaccatcgggataaggatcttggcccactattatcaccttaatctcttca
ggcgaacataaataactccagctgtgtacattctgaggatcggggtagataattaatctt
tctctgtcacgctgaaccaatttgtatacattttgtaattgtacaatgtcagaatctgat
aagtttaaaaacttaagccacttcacattgatttgaaacgtttcatgttgttcttcaaga
gacatttttattgagttgtcatctgaaatgttttccagcatccactgtagtaatgccatt
attgaatgggagaagcagtgttcatgggctttttattaatgttgcctgaacacgtgacac
ataagttgagcgatctataaagcatgcgtcagtaagttctaatgagcaaattcgaaaact
cgcttcggaatggaagcacttcattatatttttccatttcttgaattaacgggaaactaa
agttgtaatacctagaaaaatatctcaaacaatttaacaaagcatcaaaaacattaattc
catggtgatcaattctcacaattctctgtgtgcgagtctcttcattttcaaggtaaatca
aaattgacatgttaaaatttatcatatttgatggtatattgaattcaaatccgattatat
tttctacaaagatgttgcccgtgaatttgagtttttcataagagtatgatttacacacat
tatctctacaggttaaaagtgtgttatctgaaagacatctttcaaagttatttaaaaagc
caagccagttgtgccctgattctgaatctttaattaaggaaagtaaggtgtgtagttgat
taggattattatacagtaggtaaaatgtttctaaaaaatcttcatcaattaaaacttgat
ctctccttgagatatagggagtatgatataataagcgagaaattatatccgaatttggta
taggtgcctgatcaataggttccagaagcgacagagtttttgattgggtacaatttagaa
tgtttttgatacattcttgttctaaattagaataataagagttattaaataaagcatata
tttggtttagaatggagataagaaatataaaaaagatgttagttttcatgttccataaag
ttgtatacaaaacaccaggaacttaaatatggaagacacatttaaatggaatctaataat
ttacataccgtttttgaagtgagctttctaattatttcgtgattatagaaattatcattc
tgttaaatactctgaaacagaaaatctggaattcttaacagtaggttttccttacctgta
ttagtagaagttgtatttttagaagtcgaatctgagtcaagatctatagaaaatataaac
tttatatcattccaaaagttaagcaataaatatataacgtaattcgagtcaatcagagta
cataagttttaaaatatactatgtctttaatagtttaccataatcgtcccagtagatgta
tctattgaaagtattatagatgattaaatgctctttaagtaataaaggttgtgttaactt
tgagacatttagtaaaatgtcagcagggtaacgaattgaaaattggacacagagatgagc
agcacaaaatagatctttttcagttggggcatttatgtacagagagtagacaccactatt
tttcctgtgtttgctgttgacattcacaggcatcatagcttcttttctagtcagttcagt
atgtggcactgttcctctgagaaatctgttaattgctatggcagttttctgttcatggaa
aaagatctcagaaacggtttgttcgcctttgttaacaatcagattagctatttccatcaa
tttttcgtgaagtgagtttacaagtaatccgttacgtgaataaacttgaatttgaactac
agtcgaattataaaatcgaagtaatttataaacttccgataagaaatttttcggcgaaca
taaaccgcatggatgcataaaatcacaattaaaatctgtataattttttatttcaggaga
gtggataggtttggaatcgttaaaattgctgtgaacaatacccttagattttgttgcaaa
gtttgtcgttgagagattttcttttacagccttaaatatttttctcaatttagaatgttt
atagatggcattcgtatatttgtccgccttaagtaacatttctgattttgaaatgtttat
ttcagaatttattttttcaggaattgtacattttatggctttttcattaaacggtaacgt
ttttgaaaaacagttacatgtatatcgagcattggctttagtacacatgcagcttttaga
agtgagtttacctttggccttacaaacagttttacgttttttgcccctcatattcaagta
ctgaagctttcaaaattttcaatgttgatgagttcctagtttacacagaagggttgaagc
tattataacgaaaagcaggacactggagattattaaaattatccacgccaaatcgttgtt
aattaactctgactgtttaagagaatcatcacttaatattgtatcattataggggttttc
aaatggttgaataatcgaggtaacattctcgtctatctctccgccgtaagacagacaagt
gatcggtttgccaaagaacgtattgctgccttgtcttttaaaaagaaagctgagtgtcgt
tgtctgcgagccgttgtaattttcacgcactgttggactgtcctgtctatatatcttatc
taaaaataaaatggctactaatggctttggatacgacgtcacagaacatgttacatccaa
aaaattttgcagatggcgatagtacaaagcaattattggcttcattgaaagatgcacaca
actcatagtagacaatcgagtcttggcgaagaatgcacatgttaagcaaccagcatcgtt
aattgttcgagatttaaatttcagcaatgctgtgatattgttagcattgaagtaaataat
gctttctttgtcacgatgtttaaattcatgaactattttttcactcatgtttttcaggtt
tttggtatttatggtatgatttaatatcagttcgtaatgtttaaaccatattacagagct
gagatttttagttgtatcaacagtacactgaaatacaattgtgtttcctagttctactct
atgatgcattattggagataatgcatatatgattacagaaaatccaatcatctttatgaa
aattgcacctaagaaaggcattgtgtgaaattgtctgattttggatttttctgcatctat
attatctggacacaccctaaaaaaccactattttttctcttttactttgatttttgtgtt
ttttttttaaaatgtggacccacccattcaaaaataaggcgtttggggtaaagcaaatgt
aatctttattttttttttaaaatttacaaagtgctgtgtattttgaaagaaaatctctac
ttacaggattatagatggaaatcggattatccccatcggtgatagagcttaatcgcagaa
caatttcttttggtctcttttttgcataattgttacagattttagctgccatgaaaaaat
ctattggtgttgcagcgtatattataattgttttgagatctgaatgtcttgtatacagag
tatgtgcactattactaatgttctcccacaattcatgcggtccttttttttgtaattcga
tgaaattctttatggaatctttgtcataatatcgcgggggggcgtggttcattttaaagg
gttcagacatggtgatattaggtcttaccattagctctttttgcatggcttttatgtctt
cggcaacagtttttgacctggtaaaatatattataagcgcaccggatttagagcttccat
tgcagcacaaagcataaaccgattctttcaatttggcttccggaaacggtttttttggaa
tttgtttatattcaaaagcgcggattgtttttcgaaacagtttttcaaaatctttagtgg
gaacacgaccacgttgtactttaaatttagctgattgcttttgctcttgtaattttacat
actccctgtaggataaatcattatcagatagttctgagtcagatttttgggtaccagata
tccgctttttgtagaaaagctgcatgcttgagtccgaatcatcagaaaaacgtttcctcg
catttctgcgtttatttttaaaaaatttattagtacttttcttttgttcatactcattcg
gaatacttttggccccatgagtaaaatctatatctacacgcttgcttttttgtgtagatc
cagaagaccacgaatgattagaacagcttctttccgatctttttttgcaatctgattcag
aagacctgcttctacttcttagagtttctgaattcttatttttacaggattgataagtgc
tttcagaaatactgtgttctgaatttgatctagatatagatatcaaatgtttgcattgtg
tttccgactgagaatcttgtttattgttagaacacactttacatgttctggatttagatg
cagatctagatctcgatgtatcagagctgcttctagatctgtgtttttggcgatgtcttg
ttttagtactttctgaacatgattctgactcagtgtttctgtgttcgtgccgtctctttt
tagaagaggaaaaggattgggattgtaaatctgaattggtatccgattctgactctgtgc
tcggtggtctctttttccttatgtgagggcgaaatcttggattatacaaatgttcattgt
tttgatctaattgaagtctagattcaacatgtttatacaaatttagctcttttccacacc
tgaattcaaattctgacatatcaactttgctaacaaaatcacactgtctattgccattag
aattaggagattctgtatatgaaggttttaactctgtagaggaacaactatttctactta
atacagaatttttagaagatgctgagctagatgacttacaactgcatttactgcttgaac
tgctgcttgaactcgatgtatccgtatcagagtcactggatgaacttcgtgtagattttg
gactcatagatctatcacttataggaaacttttttgtttcagaggagttctgtgtgcatt
gtaattcattatcaaagaattcaaatagcccattctctgtgtctgatttagctaaaaatt
cttgctcaggacttacaaaattttgtgctatttcatctgtggtttgagaaatgatctgtt
ccatgtgttgattttctatgctgtgtacatgttcaacttctgactgtgaataatcattta
ctggtgatttatattgtccttcctcagtactacttgaatcagatcgtgtcctttgtgtaa
gattgtcgttacacatggaatctgttgtatttgatttttcagattctacagggggattat
cgatagaaggtatattacatggtgctgtgactttcccctcaaaatcgttgtccttagcat
ctattttggaattaacagtagtttttgcttgtctaggtctacctacacgatatgaatttt
ttcctgtacattttgtatcagagaaaacagtactagaattacaatttaaggcagtactta
ctgtacagcgtgaagattgcttaatgaattctatatcagaagcagaaatgtctttgtcat
ttttttctaggagtcttttaaaattaatcaacttagttggagctcgttgatttgattcct
gtacgtctggtttaggagttaatggcagtggagaaagcattggttctagttttgataatt
ttctgagattttctatagcttcatctggtgatttgtcctttttctttaagtttgaagaac
ctttgtccaagttgggacaatgcttagaatctgtagtcgatgtgatttgtttttcttttg
atgtactaggtcttgttctagctttcataaaagtcttttcctgtgaagacttgttatatt
tacatttgtctacatctgaagtcgaagatagactgtctttagccaggggaactatatcag
cattataaattcttttaattagatccatcttatgagaacttggaatatatgacaagctta
caacatcctcattttgtggtgttttgtctttgtctgtctttttcctggcaggtttttcca
aattgttcacgtttgagattaatttggtttccttgtgatttgtctgaattggtgtatttt
gactgtattcacttttctttgataatgtaagacctgatgaaatacattctttttgaaggt
tttgactatctgtgatcatagagctgcttggaatttgtgaaaaagccatgctgtaatctc
tgctttgaaagccatagttaggacaaagttgttgataattgtctctgtaaggattatgtc
taaaatctgaattgtatgagtcatatgactgatctcgttgcatatattccggaaaggtaa
attcatttctgttggaaaagtcatgaaatttagcatagccacgtccacgtctgttgtaag
gtctgtgaaaatgtttaccataatgattttggtattttgagttagggttacaataatttc
tactgtcatattttcctctgttgttgcgacccctgtaatgatgttgtcgataggttgtat
cgaacgaattgtgacaaagttctctatttttatagtccaaattgttaaaaatatcaactg
aagattggggttgatatggtaaagagataaaattttctccacttgcttgaggataattat
aatacaatgattgcagtccttgatgtggcaattctgatgcaaatcgaaattgtccagttt
cagttgtatttggagaagattcagaagtaaaagtacttcttgatttaagaggaatagcac
gtcgcggatcttgaagagtttttgatgtgactatttcttggttgttaaaatttgaataag
ttatttcattttctggttttgtatgatcgtgaatttcattatataaacccgaaagagtca
tggcttcacgaaccacgtcagctgtagtgctcatgggtgcatgcaatggtcttttttctg
aaaatgaaaaataaaaattgtttattttaaaatgttattaaattagcgataatactaaga
tgatatatacctttaaatagagtggaaatgtacttttaattgtctagaaaatataacgca
atatgttagttaaaaatgtaacttgttagattgatatttcatgggccctgaaacctgcat
atgagctaatgtgtgtacaaatttgtgacaataaatattaaagtggaaacattccaaatg
tagcaatttacatgtaaacggatatgtaaatgtaataaagatgtgtatggttatgtcaaa
agagctaatttgcaaacatgcagttattaattgtaatggatgtacaaatgttgatacatg
tttgtgtctgttgctgtgtatatgagtttatgttaaatgtttatgtaaatattatatgtt
ggtacatatcaatgtatttatgttgataagcagatgttagtatgtattagtatcaatgga
ttgtagtatgctactgcatgctattaaacaagtagagtgtttacttgtattagattatat
ttacatgacattgtcatgtaaatatatagttgcatacatttttcatgtaacaacacatat
gtgttcatgtacatattacataatatatgctagtaaatgattacatgcactagtaaatat
ttgcacatgctaatgtgttcatgtgggtatatgtacatattacataatatatgctagtaa
atgattacatgcactagcatatatttgcacatactaatgtgttcatgtgggtatatgtac
atattacataatatatgctagtaaatgattacatgcactagcatatatttgcacatacta
atgtgttcatgtgggtatatgtacatattacataatatatgctagtaaatgattacatgc
actagtaaatatttgcacatgctaatacataacagtacatgttaataacttttgatctat
gccgctacatgttagtacatgctatactgataatgcgtggaagtttattatttggatttc
tgtaaggtcatgtgtattctatgaatgagtatataaatgggtatgttaatatatgttagt
atggttgcaagtaaagatatgttaatgtgtattagtaagtacgtaatgtatgtgaatgta
ttcaattttcaaagaaatgatatagaaatttctaaacatgttattgtggaaaatgtagat
cttgtgatctattataataatataaacataaattaaatttttaagttatagctaccaatc
tttgcctatttttcttggggggcatactttttatatgattttatatgtacggaaatatat
gtacgtagaataaagaataaaatacttgaaatcaaaccctgttataagtaaatttactta
gtatcatatatgtataaattttgataatttatgaagatggcataaatgttgaaaatattc
atgtgtttgttataagaatttcaatgttactaaaataaaaccaatcactaattatctttt
atatgcaaaaatgtgtctttgtatatattcaaattaaaatttaaaacttatgttttaatc
atgtgaaatacagatgtatgaatatgtagcatggaaacttcaaaaatataaatcatatag
acctattgctttaactatatttaagatttacatatttaaatattacataataaaaatttt
aatatttaaataaaaatatgtattataaatatgttatttactagtacagctttataaatt
aaagaacatatgtatttaaagtttaaaaactaatgaaatgtgcttctatgagttaattgt
aaatgtcaattttgtgattttaatatttttctaaataatgagattcaatgttgttaatta
gatgtgtgcagtttgagaacatgtttatatttacaaaaatttgtatatatttaaaaatat
gttaatcagcatagccttatttataatgattaattttaaattctatgtaattaaatctta
tggacaaaataaatttcaaaccatttattttgaaaaacataaatgcagtttagaactgat
acaattttttttttcaaaaggggtacatacttaaaagattttttacagtggttataaaag
tattagaaaaggaattaagatatatatgaaaaaatttccatcctgcttatggaactataa
tatatcaaagcaatttatttatgaaaattccaagtctatgaaagtaaagatacccattca
agtgaaaggctattatagttaggagggctagcaatataagaaaacttatattcaatgtat
ttttttttaagctatgaaagtaaagatacctattcaagtgaaaggctattatagttagga
gggctagcaatataagaaaacttatattcaatgtattttttaagctatgagataaatttg
ataggtctaaaacattttatttataagaaaaaaatgaaaaattttatttcatagatacaa
taacacagatgaaagttacatttataatgtatctatccaaattcttataatgtgtaaaca
gtaagttaaactaatatgtaaaatatttaagtaaaaaaagtataaaaaacttaaggttta
tttaaaagtccatattttataaaagttaatgaaaaagaaactgaatagaaatagattgat
aagtccatatgcaaaaactacaatttcaacaaaaggaaaagtgatgtttaatagatttga
gcattttccaaaaatggatcatatccctgtggataaccttcaagaaagtcaacataagtt
tgatcagaatctgtgttttctttcccataattttgagtgtcaacactctgttctaaaata
aatgagttcatctcacttacatttttatttgcatatctcttttttaattcttcataatgt
ctattaataccatttttaatcatttctgtgatttccataaaattatccatgataatattt
gttaccatggttttagtctctgaaatgctgtcaacctcaataaaattttcttggagtttt
ggaaatatatatgagacattttcccgcctatattcttcatcattacttcttattggaata
aaatgattattaaaacaataacttgcttgtttggtcagttctttattttcatcttttttc
atgcctgtgtctggaatgttaactttatgagtcttacgtaaaaaccacaggcagtttttt
ttaggaacaattttaactctgacacctcttgtcaccccccgtatggatctgataggaatt
gtgaaaacaacactagggaatccattgttttcacagttatcagaattgttaattagtttt
gatctgtaaggaatagaatctgtagacatctctgtattaaaattactcatgttttcattg
tctgtatcagtgcaagaatttaactccatattattgcagccctctttaacaattagtttt
tttttttttgctttgctagttttcaacttgctttcactttttctctttaattgttttttt
ttaacagcactgaaatcatgtgctgtagtctgtgagtcactgaaggatgttagactgaca
ctactgaatgtagaatttgtatcagtgctggagctctcactttcatatatggttgattta
tctgtatcataaccatatgtttccatctcagaaatcaccagatttgtattatctgtatct
ctactgttattattggaattctgctccaataaaatcaatccttcagcggccactttttcc
acatcactttctgtgtcaacatcagctgttgatctttctacagctctattagttgaaata
tcctttttcttatctctgatgtaaaaggtttcattaggaaatttatctggaataattaaa
tcttttccatctttatatttgttttcatttctgttaaggttatgaaaatttacattggag
gttttattgccctgactaacactctgtttatttttaatcatttcttcttgccctgataaa
gacttatctgttttaattttaacatctgttttgtcttcagacagattgtgacctttgttc
tgattatctaatgtatgatttgtcatggtaaaaagttcaaagtactgttctttatcttgg
gtgtccttattaaatattgacctttccatgagtattccagctgggctatttgttttttta
tctgttctggaaaaggtaggaggaaattcatttgaaaatgtcaaagagttattgacgcaa
atttcctcagttactgacctttccatgagtattccagcttggttatctgtttttttatct
ctcctggaaaaggttgtatgaggaaattcatttgaaaagttcaaagagttcttatcttga
taagtttcctcatttcttttaaggttatacaaactcatgttaaaggcttcattgttctta
ctgactttctgtttgtttttaatagtctttctctgtcctgttagaatttgatctgcttta
gtatccctgcagcttttcatagtagcctctttgaaaaaatcctgtgtggctgctgcttcg
gaaagccccgtctcattttttatagcattcacttcagaatttttctcaactgagattata
ggattatcagataagaatctgcaaatagtattcctggaaaaatcctgtgtgtctgttcct
tcagaaacatttacctcactttcttcagtactcattccaggatttgtttcagctggatac
atgagacagtcaggtgagtcttttgaaacaacctttttggcaagattctgtgtatctatc
tcttcaaagaaatctaatttatattctctggtacaaacttcaggattttttccagttgtg
tttttagagtgtgattcatctgatgcttgtgaaacagccagagttgttttaatggtttgg
catatgtctgaaaaatttgattgaacattgtactgttcagactttgaaacacactgtgta
ggactgacattctgatgtacactttggtaggattgttcagatgtttcagaacattcctca
gaatactttccataatcattaaaatcttcaatttctggtggagtcgagtcagaattatat
aagtgtgactcaagcaaagtggaagagtgatgtccatttcctgtgacatatccatttcta
atggatattgaatttaacactgtaacttctcctgtgacatcatatagcttttctatttga
tcacaagcatcattaatcatatgcataagtgtgatcttaaattcttttctatttgccctg
aattttttgcatgaaaattctttagagcatattacaatacactgcagtacagcagctcct
aggttttttgctgcctctattaaatttatacaattgaaatgtattttaaggaatgtttcg
tcacacattgacatgaacatctgattcatctgtttgattgcaaagtctttcatagtttga
gctattctgctgtttttttcaattatttcaaatttacattccaacaaatcttttttaatc
ttatttgtttttatgtagaatgcctgattggaaatgtttatatctgttatgtctctgttt
tttcccatcattaataacattgttgcacatctgttaagtttctcattactgcttataaag
ttgcccatacttatgatcttttttatacatttgataaattctctatccatattatttctc
aaatctgataaatattctctacaatctgcaatcacttttttaacaatttcatcaaattta
tcacaggcatatacagtgtatcttgattcacaccaaagaaaaaattctaattgttctcca
gataagatatcttcataaaaagatataaatccagaggaagcaccactaattaaattaaca
tttagcatctgagataattgttctaaagcaagatctgtaagcatgtgtctgtcattcgtt
aaaattccagcgtggttaattaaacaatcttcaatgtctgctttttcctgatccatggca
gcattcacggatttaagaataccttggatgcaggcactaatggactgagctagaatttaa
agaaaaaagtctaaatatgaaatctgtacacatatatcatattttatatgtaagaaaatg
aaaaaaaaatacctgctgccagtttaatatccgaggaagctccttcttcaacatttgtgg
aataggaagcatttgccgttgcaatatcattagatgatattgagtcaaggaaatcaaaag
aatccaattcttggaagagagtattatcaaaggaagggttgcattttaaactgtcttgca
atatgtctctgatggtctcttccacggtggtatctgggtgatatctgtaataaaatttat
aaattttattacagagaaattaaatctgtcttttttgtattaaaatatttaggtttacct
actcaatatgtctttcgtcattcgatgccatggtttcagatggttgtccaacaatcaaca
taggtgaagtagctccacttctttccatagttttatctgtatgtttagccacacctacaa
taacaaaccaatcagaaatattaaccccattccaaactcaatataaggccagcctaaaaa
tactttcaagcagagttttaaaactctgcttgaaaaaaatgtatactctggaatatgaaa
aacgtgtatcaaggccaaaacttacttattggatcattttggcaatattatttgtttttt
taataataactggatctgtattaattgtaattgaaactctgtcaattcaaagaacgactt
tgaatgctcaaaatgataaaacaagtactgttgttccagaattaacatctaattctccag
gtttgttcagctataaaatgtcattgtttaaaaaaaaagtttgtaactctgttaatatga
atattttttcttgtagatcaaacaactgtgacaaatttttctgcaagttctaaaccaact
cttagcagtaaacaacccggatggatacaggcactaactacagcttttggaattttaaca
ctgttttcagttatgatgattattataacttgtaatttttggctaactgagaaaaatgac
aaaactgcaaatccaacagaatactactcagaagacatattagattatacaaatccaagt
tttacagaaattgatgaagacagctcaaaagtataacattgcttcagaaataacaaaatt
gtaagtaaatttacttgattttcttacactatgagatatttaatggttttaaaatagaaa
atgtcagagtttaaagtaaaattaatgtaatttatgattttttaaatgtgtcttacaact
agaaaataactttaaattattattagtattgtaataatttaaaattattaatattagtat
tgtaataatttaaaattaataatattagtattataaacagtttttaaaatataaaaaaaa
taaatttaaaatttatattaaatgattttaaatttacttaccagatggcagcgatatatt
ggaaattctgtgtagcagaactgtatcttcaagctcttgaagaaaaagtggcaaaatagt
tgatctgtcttcttattatatacattttgaagcggatgtgatgcacaggaaaatgacgtt
aatatatcaaccaattaaaaaaagccaaaaaaattataatactaaaaaaattagggttta
accttatttgtacatgtatttttttaaaatattatttttccaataaaaaccacaatggat
ttatattttacgtaaacatgatttttgcggttattttatttcgaattggtatttaaatct
ttgaaacaacaggaattgcggttgtcttctcagcaagttctacacattcccactcgcttt
aggcaggaaagaccccaaccacataacccactgacatttaaacccgtgaaaacaacagga
actgcggttgccttctcagcaggttttacgggttctcacccgtttaggcaggaaagaccc
caaccacataacccactaacattttaatatgtgaaaacaacaggaactgcggttgccttc
tcagcaggttttacgggttctcacccgtttaggcaggaaagaccccaaccacataaccca
ctgacatttaaacccgtgaaaacaacaggaactgcggttgccttctcagcaggttttatg
agttctcacccgtttaggcaggaaagaccccaaccacataacccactgacatttaaaccc
gtgaaaacaacaggaactgcggttgccttctcagcaggttttatgggttctcacccgttt
aggcaggaaagaccccaaccacataacccactgacatttaaacccgtgaaaacaacagga
actgcggttgccttctcagcaggttttatgggttctcacccgtttaggcaggaaagaccc
caaccacataacccactgacatttaaacccgtgaaaacaacaggaactgcggttgtcttc
tcagcaggttttatgagttctcacccgtttaggcaggaaagaccccaaccacataaccca
ctgacatttaaacccgtgaaaacaacaggaactgcggttgccttctcagcaggttttacg
ggttctcacccgtttaggcaggaaagaccccaaccacataacccactgacatttaaaccc
gtgaaaacaacaggaactgcggttgtcttctcagcaggttttatgggttctcacccgttt
aggcaggaaagaccccaaccacataacccactgacatttaaacccgtgaaaacaacagga
actgcggttgccttctcagcaggttttatgggttctcacccgtttaggcaggaaagaccc
caaccacataacccactgacatttaaacccgtgaaaacaacaggaactgcggttgccttc
tcagcaggttttatggattctcacccgtttaggcaggaaagaccccgaccacataaccca
ctgacatttaaacccgtgaaaacaacaggaactgcggttgccttctcagcaggttttatg
ggttctcacccgttaggcaggaaagacccgaaccacataacccactgacatttaaacccg
tgaaaacaacaggaactgcggttgccttctcagcaggttttatgggttctcatccgttta
ggcaggaaagaccccgaccacataacccactgacatttaaacccgtgaaaacaacaggaa
ctgcggttgccttctcagcaggttttatgggttctcacccgtttaggtaggaaagaccca
gaccgcataacccactaacattttaatatgtgaaaataaacaggaactgcggttatagtt
tcagtacattctagagattacatcctgctaaggcgaaaaacactttaaccgcaaaagcca
ctgatttttaaacttgtgaaaataacaggaaaccacagaaacgtcaggaaaaaaacgttg
ttttataattatgtccataaaacatgcaacataatccaaaccggccaatgatttttctgc
ttaaatgtaatttaaataatttattcatacgtaagttgttatagccacgcctacgcagca
atgtatataagcagacaccgtcatttcgcagttagtctgctggaaagcttgtgaagacta
cataaaggtaaaaatttgacatttgcaaatgtattttataattacattattttagtttaa
aaaatccaaaattcttaatagaaatttattgtgaaatttaaaagattttgtaaatatgca
ttaatatctattaaataattgttatttgacagatttactaaatgtagtgtaaaatatcaa
aaaaatttaaaattaatttattctgaagtttaacattttttaaatatgtctatttttagt
ttcatttgatacattgcgtaggtttggaaatgtgtttcgaaaattgctgtaaaaattatt
gactcttttttaaatttatagaacattggatgtaattgcacattcctggaaaattcaaaa
aaagaaaatacagtaagtcaatttatatgtattgattttaaatggcctccaataaatatt
tttagccagtttaatgtaaaacaaagcataaagtttatgtagttttaaaatgatgccata
ttttaacgaaattcatttaaagacagtatctattaagaatttaaatgcagttctatggct
ttaaaaatttgtacgttttatttgaaaagtttgctctatttgaaatcaaatgttttagat
atttcttttcataaattcagttgaaatatgtttcatttataataggtatttttctgtttc
taaaaatagatgataaaagtcactagatagaaaatatcttataaattgttatttagtaga
ataaacatctttttatataacaaaaacacaaagtacatgactttagaaagccaactaaat
gcattattatttaaaaattacagaatcaacgagtaatgtcactatagttttttaaagtaa
cttttaattgttcacttctagttgtaatcaaaagaaggatggagagtggggatagtttcg
gaaataatcaccaagtctcatcgaattcagatgcttttcaattccggcaatattcaacaa
ctgtagatacttttgcatattcatcaatggatccttcaaattgcatgcttaatgaacaaa
ctcatttagaaacggtactagtttatcctgtttacaacatgtcttcccagcaaacagtgg
agagaaatctctatgccaataatataggaaatggaaatgtgctgagttattgtagacaag
atagtttgcaaggaaaccaaggaacatattttccaacatatcagggatttcactcaaaca
ctcctcataacttttctatagagaattttaattttggcaccaatgtcatcaggcctatac
catttagaaatgagggagtagacgcatcaacatccaaagattatgactttaaaccttgca
ttacaacgatgcaaatacagtttagtcagccatctgcttttcaaacttattctttaatga
atggaaattttagtgaaaatggttatggatacaatactaagattggtgaaaattgtgcta
tgtcttatgttgagcaagagtctgtagactcaaaatatccaaacaaagaagttagtatct
cttatcaaagaaatgaacattatgatgagaatctcccgacgagagagcttaatacagatt
ttccgcaatataatcaaagttctgtgttacagcacacctttgcgaatgtccaaagcatta
tttcacagcaaagtccatatcagttgattggaaaagaaaacagctttaacaactatctgg
aaacagctaacgttgatagtgattgtcaatctaacggggggcctaaaattggcctagaca
cagatcaatctgttttttcagatgaagtgactggggcgtgtgtagaaaatgttcattttc
caatgaatcctaaaaatgagtatgtaaataacatatcacttgatgtacaaactgaatttc
ctgtgactgagaatcctcttgtaggagaaagtcaggctacaaagaacaaggatgtggaca
gtaacgcagaggttaataatcattctaaatatcgtctattgaaacgcaatattacaccga
ccatgggtaatattaaacatttaaattttagttgcaagatatctaccgaagaagaaagga
aaacattttttaacaggttgagtgagctattgaaaataagggatgatataaaaaacacta
aaatttcttcaaaagtggattttattcaatctgaagcttctacatcattggacatttgta
aaaatacattcaataacaattcggattcatcggatgtggacactgatatccttgcagaca
acccattagtgatatgtgaaaatgaactgatttgtgataacaatgaggaaaacatcaagt
ttccgcctaacgttgaaaaagaggctgtccccatgcagacggttaaacgcagctttccag
aaatctgtccagagcattttaaaaaaagaagatttataaatggtgatgtgatttatgaag
atttaaattctgtttataaagtgatgccagcaagtgcgacatatgacgatgtgcgtttcg
gagaagtggattatcaaacctcttcggctcagacaaaaatttccaaccaccagttagcgt
tgttgccaacaaattatcagcacatgatagggcaggaaacagacatttcatcgcgggatt
atcacaatgacagtgctcaaattatttacaattgctcatttcaacgacagggaaaaaggc
ttcttgctgatattccatatagaccttggttaaaagaaaatgttcccacaggggaatatg
gaaaaagatttgtcaaaacagtccctagaccagccagtgtttttatttttggaagatgtc
gaaaaaaaatgctgagggaaagcgttaaatcttttatgcatttaagcaagttacagtata
ctaaagaaagtctagaagcatatgtacttagaaattgtaacaagtttttagatttgagtt
ggccgatacgacacaagatctatattatgcctgatgtgagtagaaattataacattgaag
aggttaagaatttatttcccgtaccggaaggctggatggtaactctaggttttgtaggaa
cagaagaaccggtgaccaaaatttataacattgctgtattgttatgtgaaaatgggtggg
tcatgattcacaagaatgataaagtggaacctgaactttatttagctgcttcgaatctca
atgaacttatagaggatggactggcacgctgtgattgtatttacgagaaaaggtctgtac
catatggaattgtcatggaaggaaaattaagacagtttatggacaattttggctcactgc
aaagtgtgctagcctacagaaagtatttacatggttttctgtgggcttttaatggcacac
ctggaagattggcagacagagtgttccatacttgtgtacctggggttcataatgcccttc
ccttagatgctgtgattaaacatgaaaataatcccttgtatttcattggatatgtaacca
cctttaaacagcaaaatgatttcaatgctaatgttttcatcgcggtagatggaaatttaa
gcatttatggctatcatcttatatctcaaaaaacttggtttctagcaaaaacattttcaa
cttttctgaaaatgggaactagaaagatgtactatgattatgagattccacttaaaattc
atttaggagatagtgcagattcatttctgtcttgttttaaaaatgccccttgtctgctgc
ttaagccagaagtacttagaaagcaatttcctaaaccttagattgttaaaacttggataa
ccaaactatattgaattatgtatatctttttattgaatgggacatgtttgtaaacatttt
tgaagcttaaataaagagtgttttcaaatatctctgttttgtctctttacagaggacttg
aaaaattttttactgtctttagaacttgcgaatacttgttgagcttttctttccgggtaa
cgcatctccacagtggtgcaggtcgcttcgtaaatataatcaaaaaattcttctacttct
agtagttttggtgtcggatcttcattggcgccataatttgaattaattctagcagctttt
attccttcccaactaaaagagaaaatgtttaaattacagtaaattgcaattggcattcct
tggaaaaatgatgctcacctgaaggctttgtttaaatcaatccacggtggcattggttga
gtctttgtaggtttgttgttaggcgtaggtttaatttcatgtatgattgttgtactcgta
tatataggagtgcagtatgtaatacctccggcctgatatatgctgcgaacgagaaattaa
gaaatgagtttgtttctaagacgaaaagtattgtcccatacagtaaaaactcacatgttt
ccgtcgtcacatgtcagttctatcacatcaccgtctgtaaatcgcaagtattcatcacag
caggattctagtttaggtaattgaagttcgctagctagaattaaaaaaattctatacaat
atatagattaatctatatatgcacatcatggacgcattttatggcttcgagctatacact
cttttgttttattcatttctttaatactttgtattttatagaaactaaataagaagtttt
aatgaaatgcatttattaaccacccataacattttgtaacttttcggatacagtattgtt
aaaggcttgagttatatttccactgttacacagttgagcatttaaagatttgttcgagat
gagtttttttgttgtccggtcatctttttttaagaaagtcaataacagcgtatcaatagt
gagtagtcttccgttgtcaaactctgtttttgcactgtcggttttaattttaattgagct
ggtatgaaaaaaaaaacacattaagttttcttgttagattcttatcccccccccccccga
caggagagttttcaaattaccaaggtccgaaatctttagatggtgttagtagtacatcgt
attggagatccgttgtagatatcttagatggaaagtcttgccacatagcacttacgatgg
ctggatcgaattctctaggatgaagaagcgaaaattagattatatctagttttgctttct
aagttaataatatttacaatttacctgttactaaacgactgtcggtgcggatgtggaaac
atgtcttgtacagtcttttgtccaatagtgtcgaataagcgttctatttctagtagtgct
attggaaaaagactgcgaaacacaatttatttgcttattctctccagtttttaaatttcg
agtaataaaagacacttgcttttcttacattacggtggtgacgtagtttcgtgcagttgt
atcgtttttaggcgagcaccaaatttgtccatatgtagactggaatctaaaaaaaaaaat
attgtcaactcaacctttttgtcattttgttgattgcatgtatgtgcggttttcctcttt
tttagtgtgcttgttaatatgagcagttttgtgcgacagtacttacactgtagtgtttgt
taagcacctttcgtccgtgggtatctgtctaataatgtctatgtctctccagggttcgat
ggttgtctctgtccagggatgttctgaccatcgccacgcgtatgtcgtgttttctcgact
tttgttcttatccgggcaacaagcgtcatacaatggtttttctgaagtcatgttcacttt
aggtatgttaaaatcttcttctttccattgtgaaaattgcatgcaagtttcccattcgta
gcccttgttgtcttttcggacgattgccagtgatatttgtgtccgaaaggctattccgct
gtagctacgcatctttttaaaatctgcgcgtatctgtaattcactaataagcgggtactt
tacattcaaattcttggagaaaaaaataactatagatagtacctttttttgcttaccatt
gagcagacgactgggtgtattgctcacgtctttcccaacggtggcgagcagggaacaaaa
ccaggctcgtcaaaatgtttgcggtgttcattcttttcacatacaacaaactgttttgtt
tacttccgaatcctccattaagtagagaatagtgtaagcctgtagttactgacaagactt
cagacagccctttactcataattttttctcttaatccgcgcactcccaatgagttctctt
ttagtggaatgcagagtgttgtttctaataatataacccttagaagaattaaaagtaagg
tgtgagaaatttacttaaaaagctcttcaaagtcgtcatattgtagaaatcagtgtaacc
atttttacttactgtgcttcgtctggccattcacattcgcaggaaaacgatgtacatctt
gtgtattctaacaagctttgtctttcctcggaacttagaccaatatatctagtagagctt
gcgttgtgcatgttttcatttattaagttttcgattatatcttctagagttattgccgtg
cgtgctttttcaagtgggaccgtattggtacatatctttatgagtaatgcgaaaattata
taatgcagttgcaccattatctgcgaagagattttttttgcagcgtctttatgtgcaggc
ttattcccccccgtttcgtatttcaaatcctaaataacccccggggggtaaaaaaagggg
gggagctaaccctaaccctagctctaaccctaaccctaaccctagctctaaccctaaccc
taaccctaagtctaaccctgaccctaaccctaagtctaaccctgaccctaaccctaaccc
taaccctagctctaaccctaaccctagctctaaccctaaccctaaccctaaccctagccc
taaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccc
taggtctaaccctaaccctaaccctaagtctaaccctaaccctaagtctaaccctaaccc
taaccctaaccctaaccctaaccctgaccctaaccctagctctaaccctaaccctaaccc
taaccctaaccctaaccctaaccctaaccctaaccctaagtctaaccctaaccctaagtc
taaccctaactctaagtctaaccctaaccctaaccctaaccctaaccctaaccctaaccc
taaccctaaccctaaccctaagtctaaccctaaccctaaccctaaccctaaccctaaccc
taagtctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaggtc
taaccctaaccctaaccctaagtctaaccctaaccctaagtctaaccctaaccctaaccc
taaccctaaccctaaccctgaccctaaccctagctctaaccctaaccctaaccctaaccc
taaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccc
taaccctaaccctaagtctaaccctaaccctaaccctaagtctaaccctaaccctaaccc
taaccctaaccctaaccctaagtctaaccctaaccctaagtctaaccctaaccctaaccc
taaccctaaccctaaccctaaccctaaccctaaccctaaccctaagtctaaccctaaccc
taaccctaaccctaaccctaaccctaaccctaaccctaagtctaaccctaaccctaagtc
taaccctaaccctaagtctaaccctaaccctaaccctaaccctaaccctaaccccaaccc
taaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcc
taaccccaaccctaaccctaaccctagctctaagtctaaccccaaccctaaccctaaccc
tagctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccc
taaccctaaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagtt
tcaccccaaccctaaccctaaccctagctctaagtttcaccccaaccctaaccctaaccc
tagctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccc
taaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagtc
taaccccaaccctaaccctaaccctagctctaagtttcaccccaaccctaaccctaaccc
tagctctaagtctaaccccaaccctaaccctaaccctagctctaagtctaaccccaaccc
taaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcc
taaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccc
tagctctaagcctaaccccaaccctaaccctaaccctagctctaagttcaccccaaccct
aaccctaaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagtct
aaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccct
agctctaagtctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccct
aaccctaaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagttt
caccccaaccctaaccctaaccctagctctaagtttcaccccaaccctaaccctaaccct
agctctaagcctaaccccaaccctaaccctaaccctagctctaagtttcaccccaaccct
aaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcct
aaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccct
agctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccct
aaccctagctctaagtttcaccccaaccctaaccctaaccctagctctaagcctaacccc
aaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctct
aaacctaaccccagccctaaccctaaccctaaccctagctctaagtctaaccccaaccct
aaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcct
aaccccaaccctaaccctaaccctagctctaagtctaaccccaaccctaaccctaaccct
agctctaagtctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccct
aaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagtct
aaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccct
agctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccct
aaccctaaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagtct
aaccccaaccctaaccctaaccctagctctaagtctaaccccaaccctaaccctaaccct
agctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaaccccagccct
aaccctaaccctagctctaagtctaaccccaaccctaaccctaaccctagctctaagttt
caccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccct
agctctaagtctaaccccaaccctaaccctaaccctagctctaagcctaaccccaaccct
aaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcct
aaccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccct
agctctaagtttcaccccaaccctaaccctaaccctagctctaagcctaaccccaaccct
aaccctaaccctagctctaagtttaaccccaaccctaaccctaaccctagctctaagttt
caccccaaccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccct
agctctaagtttaaccccaaccctaaccctaaccctagctctaaacctaaccccagccct
aaccctaaccctaaccctagctctaagtctaaccccaaccctaaccctaaccctagctct
aagcctaaccccaaccctaaccctaaccctagctctaagtctaaccccaaccctaaccct
aaccctagctctaagcctaaccccaaccctaaccctaaccctagctctaagcctaacccc
agccctaaccctaaccctagctctaagcctaaccccaaccctaaccctaaccctagctct
aagtttcaccccaaccctaaccctaaccctagctctaagtctaacccaaaccctaaccct
aaccctagctctaagtttcaccccaaccccaaccctaaccctagctctaagtctaaccca
aaccctaaccctaaccctagctctaagtctaaccccaaccctaaccctagctctcagtct
aaccccagccctaaccctaaccctagctctcactgtcaccctaacactagctccaggtca
tctgttctagatcctatccatatctgccctgactcctggttccataccgctccgagcccc
accctccgtcccgccctcctcctgttctccatgccctgccttctcaacccttcctcttcc
acgcccacattgcctctgcactccgcgctctcttggctgtgcgccctgcctttccgtgac
ctactgggagcgccgccaaatctgttttgccccgcccctgcgcgcgcgggaactgtcggc
gccgcgctgctgctagcccgccttccagagctccctccctccgtctgcctcctcaccctt
gccactcacccttccatctcttctatcacagactctgtgttacaccacctatgactgctg
caaccacagaacattttgctctccgcgcggcactcaatcgttactggtggctgcttctgg
gacgacacaagctcagtttggtatgcaactacgtcacagctcatcgccaacagttactgc
cgctgccgtggcccgaacaggaatttctccaacttgacccggccccctactccaatctcc
gcaaccgtgtcgctcaccatctccatcgcggctggccagcggcacacaacacatgtaagc
taccgtacatctctttcacaaacccaaggctcacatagagacaagcacaagctcgcgcaa
tgacattaaaacctcccatcattgtcctttcctgtcgctttgccgataacgtctttgctc
tatcgcaggtttcgacccccgtccttacttccccaatgctaaagtcaagctgcttccgct
cggctccatcacccttaccagatcattctccagtgacgagcctcatcctattggtgatga
tgtgcatcacagtcatgaccggggtgactaccatactgttatctgcagctggctcacagg
aacctccccgatcctagtgctgcttcaaggaccggacggcagcatctattgccacgacgt
gtaccgcggccgattgtatctcgtggcccactctgtatcgttgttcgccaggctaggcct
tcgccactgcgaacctttatatgcggcacccagatggaagcacgttcctctgcccagcat
gtgggtggcgagcccgccagcgtccgccaccctcacgcaaacactcgccgtgagtgccac
gcacggtctggacgcgttatactcgctgctaaaaatccacagaggaactccgtgttcgct
aatccaccccgtgaacggctacgtcctggacatgatactgacgggccgctcattccaaga
agcaccctgccaaaacactcgcacgtccgttaaaacaacgccacatgtaatggacgcagt
ctgcggtggccgcgggtcatggctgtccatcggctacctagtaaagatgccgcacattca
cctggcggtgacccgaacatgtctggtcaccgccatagatgtccgacaaaactttctctg
gcgcgtggcggacgacgcgctgctattcctggtcaccggtagtcttttactactgtcgcg
gccgaccgcagacttgacgtcttggtcatgtttacagcaagaacctgtgtggaggaactg
tctagatacgcgcggagaacaggatgagacagaagaccaagagatgaaacaaagcacaag
caaaaagcaaaatgagaataaaaaactcaacacctcaaaaaaacacacccgcgtatcgtc
ggcaattccgacctttcccctgagtctccgagaaacgccgccagaagccaggagcccagc
cgtcctcgccgccgccacccagtctcacaaaactcgagcgatctcgacgcataatgccac
gacaacaataagaataccgcgccttcccagttacctgctggaagcgcgtctgttgtccgt
gacagctatcctgaaagacacaaagaaaaaaaaaacccagcctcaggcgtagcagctgcg
acgctcagcgcggtgtctgaaagctcgccaaggtctcgcgtaaaagaacagatgtgaact
tcagatgtaccaaccaaataatacgggttccgctataaaaagtgcacctctattcccgtt
cttatccccgttctaactcttccttgtatcataccttgcatgttaaccggatcccgtgga
tcttacacacatacacacacacacaaacttggtgaggtaaacacagaaatctcactaact
cataatcccctacacgcttaccaccacctaaaaatggttatgaccaaaactggcaatagt
ctatcttctttttctttccattcacagccaatgtgcagtactcgtgggtccacaacaacg
aaagagactgtagagacacttcctttaagtagaccttagagacacaccaaatacaaccac
aaccaaaaaaaaaacagaaaacaacacaaagccaatgagtgcagaaatgctccgcgctgt
tcagctccagccaagacgccggggacattcctcatctcccacttcccctccactcgaagg
agagcccagtcccaagagactccaatcgagcaacagtcaccaagggcgtagaggcagacc
taaacccagagctaaaacatggagcgaagctttatcccaccggtccttcctcaacattta
cgcgtggctgtctttgagtcgagggtctccgcgaaaagtgtacggatatgccttcaggca
cagaggagaactcgtagcattgccatggccgcctaactggagcctggaacttcaccacga
tccctatcgagacgccagagcacaaaccgtttggagtcaccgctggggatggcctgcaac
acacgtgacagctcgcacggtgcgggactgcggtgagtgtaagcagtgtgacacattgtt
atcgcaattgtcttacccgattaactttttattaatgtattaagcactctttcttcacgt
gtgactgttgtgttttttgttgttatctacatcccggcagccctcgacacgcatatgtac
gtgtgctgcggacgcggagaaaagttgcagcccgtcggatacgtacgcaacagagccgcg
ccttcagacctgaactcgttacgcgtcctcctcatagccagggacggagcaatgtatgtg
catcacatgagaacggcgcgactgtgccgcctagccagcagtgtgaccgaattcgcgcga
cgagggctgcagcgagaatccgaggtttatgaagatgatgtttccttgccagaccgtcga
gtaggttcggcaacggccattcacctgtttgacgtaattacccaggcagccgatgtccac
gacctactcaccgtggccggactgtgtcagactcacaccggcgtcagctgccaactgtgg
tatacagaccacgatccccacaccgtcgctggggcggcacgcttcacactgacggtcgca
cggcagcagtatcgattgtggccaaacgcacgacgcaaactgctgcagcacctacatccg
gaccacccacttgggctgtggctgttgtgtgccgtgctcacgtacgatgcaaaagagacg
aatcgcgcagtgccacccgtaacgccaggggccgaaaccgtgtgggtgatagttactggc
aggggtgccattctaggattctggccagagagcgccaaaatgtgcagattggcctcgtct
atgaaaggactctggaaaaacggagcgcgggcgctaaaaggtcactggacatacgcagca
cccggccggcatagagcgggagaggcctggcctttgtgtgcacactaccaatctcctaga
tagaacaaaattaaaaagattaaaaaaaaaaagaaaaaaagtacaagagtgttatcgcga
aacagcgtgtcaaaaaaaaaaacaatccacatactctagaacaaactgtacccaaaaata
agtccgtgtgcaaaactgggaaaaaaaaaatcaccttcctcgttgccactagagggagta
ccgaaagtgtaggcaagaaggccacgctgtaaatgactgtcagcgtttggcgctgaaaac
attgctgttcttgctggctcaagcacaatcacgtgattaagattcctttcgttttcaaag
tgtgcccgggaggcagacatgccctttctcgtgagacattatgagatttgcctgccagag
aaccacgtgacttggacttactttcgttttctaaacgtgccctctaggcatgaatgctct
ttagcgttagccatgaggctagcgtgatcctgtatagtacataagtttctaagaatatgt
ttttaacaataatcatgtcccaaaaagtcgcgagtgactaaaattctctgtaaatgaagg
caaattaaacaggatacagacagttgtggcagtggtccgtttcgtctttctgtgttttcc
ttacgcggctgacgaggtaaagtgtctcagtccatattgttgtctgtgccaccgtagtta
gcggtggcatactaaaaactccgatagatgcagaacaataacaccgaaaaccacgctgtg
gaaccagaccacactttataaacaaaacggccttatcacctggaaaaaaaaactaaaaat
aaggcaatgatacacctgactttccattggaaacctgccgtaaccctgaccacaaatccc
atgctaaatcccctgaaacactgccaaacgtcgctacaaggtttttccgggatcgagccg
cagcaagcttaaactgaggtcacacacgactttaattacggcaacgcacagctgtaagct
gcaggaaagatactatcgtaagcaaatgtagtcctacaatcaagcgaggttgtagacgtt
acctacaatgaactacacctctaagcataacctgtcgggcacagtgagacacgcagccgt
aaattcaaaactcaacccaaaccgaagtctaagtctcaccctaatcgtaacagtaaccct
acaactctaatcctagtccgtaaccgtaaccccaatcctagcccttagccctaaccctag
ccctaaccctagctctaaccttagctctaactctgaccctaggcctaaccctaagcctaa
ccctaaccgtagctctaagtttaaccctaaccctaaccctaaccatgaccctgaccctaa
ccctagggctgcggccctaaccctagccctaaccctaatcctaatcctaatcctagccct
aaccctagggctgcggccctaaccctagccctaaccctaaccctagccctagggctgcgg
ccctaaacctaaccctaaccctagagctgcggccctaaccctaaccctagggctgcggcc
ctaaccctaaccctagggctgcggcccgaaccctagccctaaccctaaccctagccctag
ggctgcggcccgaaccctagccctaaccctaaccctagccctagggctgcggccctaacc
ctaaccctagccctagggctgcggccctaaacctaaccctagccctagggctgcggccct
aaccctaaccctagggctgcggccctaaccctaaccctagggctgcggccctaaccctaa
ccctagggctgcggcccgaaccctaaccctaaccctaaccctaaccctaacccaaaccct
aaccctagggctgcggccctaaccctaaccctagggctgcggcccgaaccctaaccctaa
ccctaaccctagggctgcggccctaaccctaaccctagggctgcggccctaaccctaacc
ctaactctagggctgcggccctaaccctaaccctaaccctaaccctagggctgcggcccg
aaccctagccctaaccctaaccctgaccctgaccctaaccctaaccctaaccctaaccct
aaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaacccc
gcccccactggcagccaatgtcttgtaatgccttcaaggcactttttctgcgagccgcgc
gcagcactcagtgaaaaaca