>AB011487|TT virus DNA for short and long ORF, partial and complete cds, isolate G103301.
gcttctgtgcttcgtgccccgcaaaacccaccccctcccggtccccagcgaaacctgccc
ctccgacggctgccggctctcccggctgcgccagacgcgcccggagatagagcaccatgg
cctatggctggtggcgccgaaggagaagacggtggcgcaggtggagacgcagaccatgga
ggcgccgctggaggacccgaagacgcagacctgctagacgccgtggccgccgcagaaacg
taaggagacgccgcagaggagggaggtggaggaggagatataggagatggaaaagaaagg
gcaggcgcagaaaaaaagctaaaataataataagacaatggcaaccaaactacagaagga
gatgtaacatagtaggctacatccctgtactaatatgtggcgaaaatactgtcagtagaa
actatgccacacactcagacgataccaactacccaggaccctttggggggggtatgacta
cagacaaatttactttaagaattctgtatgacgagtacaaaaggtttatgaactactgga
cagcatctaacgaagacctagacctttgtagatatctaggagtacacatgtactttttca
gacacccagatgtagattttatcataaaaattaataccatgcctccttttttagacacag
aactcacagcccctagcatacacccaggcatactagccctagacaaaagagcaagatgga
tacctagcttaaaatctagaccgggaaaaaaacactatattaaaataagagtaggagcac
caaaaatgttcactgataaatggtacccccaaacagatctttgtgacatggtgcttctaa
ctgtctatgcaaccgcagcggatatgcaatatccgttcggctcaccactaactgactctg
tggttgtgaacttccaggttctgcaatccatgtatgatgaaaagattagcatattaccag
accaaaaatcagaaagacaaagcctacttactaacatagcaaattacattcccttttata
ataccacacaaactatagcccaattaaaaccatttgtagatgcaggcaatataacatcag
gcacaacaacaacaacatggggatcatacataaacacaaccaagtttactacaacagcca
caacaacttatacatatccaggcagcaccacaagcacagtaactatgttaacctgtaatg
actcctggtacagaggaacagtatataacactgaaattaaagagttaccaaaaaaagcag
ctgaattatactcaaaagcaacaaaaaccttgctaggaaacaccttcacaactgaggact
acacactagaatatcatgcaggactgtacagctcaatatggctatccgctggtagatctt
actttgaaacaccaggagcatatacagacataaagtacaatccattcacagacagaggag
aaggcaacatgttatggatagactggctaagcaaaaaaaacatgaactatgacaaagtac
aaagtaaatgcttaatatcagacctacctctatgggcagcagcatatggatatgtagaat
tttgtgcaaaaagtacaggagaccaaaacatacacatgaatgccaggctactaataagaa
gtccctttacagacccacaactactagtacacacagaccccacaaaaggctttgttcctt
actctttaaactttggaaatggtaaaatgccaggaggtagtagtaatgtgcctattagaa
tgagagctaaatggtatccaacattatttcaccagcaagaagtactagaggccttagcac
agtcaggcccctttgcataccactcagacattaaaaaagtatctctgggtatgaaatacc
gttttaagtggatttggggtggaaaccccgttcgccaacaggttgttagaaatccctgca
aagaaacccactcctcgggcaatagggtccctagaagcttacaaatcgttgacccgaaat
acaactcaccggaactcacattccatacctgggacttcagacgtggcctctttggcccga
aagctattcagagaatgcaacaacaaccaacaactactgacattttttcagcaggccgca
agagacccaggagggacaccgaggtgtaccactccagccaagaaggggagcaaaaagaaa
gcttacttttccccccagtcaagctcctcagacgagtccccccgtgggaagactcgcagc
aggaggaaagcgggtcgcaaagctcagaggaagagacgcagaccgtctcccagcagctca
agcagcagctgcagcaacagcgaatcctgggagtcaaactcagactcctgttcaaccaag
tccaaaaaatccaacaaaatcaagatatcaaccctaccttgttaccaagggggggggatc
taacatccttatttcaaatagcaccataaa